Incidental Mutation 'R3432:Fam89b'
ID266263
Institutional Source Beutler Lab
Gene Symbol Fam89b
Ensembl Gene ENSMUSG00000024939
Gene Namefamily with sequence similarity 89, member B
SynonymsMtvr2, 1110021A21Rik, Fam89b
MMRRC Submission 040650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R3432 (G1)
Quality Score202
Status Validated
Chromosome19
Chromosomal Location5728087-5729653 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 5731733 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025885] [ENSMUST00000099955] [ENSMUST00000116558] [ENSMUST00000159693] [ENSMUST00000160852] [ENSMUST00000161368]
Predicted Effect probably null
Transcript: ENSMUST00000025885
SMART Domains Protein: ENSMUSP00000025885
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 36 74 2.8e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099955
SMART Domains Protein: ENSMUSP00000097538
Gene: ENSMUSG00000024939

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
Pfam:LURAP 70 152 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116558
SMART Domains Protein: ENSMUSP00000112257
Gene: ENSMUSG00000024939

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159008
Predicted Effect probably benign
Transcript: ENSMUST00000159693
SMART Domains Protein: ENSMUSP00000123867
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 33 59 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160141
Predicted Effect probably benign
Transcript: ENSMUST00000160852
SMART Domains Protein: ENSMUSP00000125570
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 36 74 2.8e-20 PFAM
low complexity region 107 122 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161368
SMART Domains Protein: ENSMUSP00000124294
Gene: ENSMUSG00000024939

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 138 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162407
Predicted Effect probably benign
Transcript: ENSMUST00000162976
SMART Domains Protein: ENSMUSP00000125679
Gene: ENSMUSG00000079478

DomainStartEndE-ValueType
Pfam:Auto_anti-p27 1 28 1.3e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3 G A 1: 125,394,039 P405S probably damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Angptl2 T C 2: 33,228,802 V196A probably benign Het
Aoc1 A T 6: 48,905,844 H240L probably damaging Het
Arsj A T 3: 126,364,975 T68S probably benign Het
Atp8b3 T C 10: 80,526,180 K708E probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ceacam5 T A 7: 17,714,976 V89E probably benign Het
Cpt1b T C 15: 89,423,741 E205G possibly damaging Het
Dhrs7c C T 11: 67,809,873 T82I probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Glp1r T A 17: 30,924,557 L189H probably damaging Het
Gstp1 G A 19: 4,036,695 T110I possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Il18r1 C T 1: 40,487,089 T265M probably damaging Het
Lpp T C 16: 24,889,886 V447A probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmel1 C T 4: 154,885,498 probably benign Het
Myo5c A G 9: 75,263,001 E471G probably damaging Het
Obscn A G 11: 59,031,177 L317P probably damaging Het
Olfr983 A T 9: 40,092,549 M139K probably damaging Het
Psg18 A G 7: 18,349,171 V232A possibly damaging Het
Ptprt T C 2: 161,927,529 E472G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rbm15 A T 3: 107,330,677 S802T probably benign Het
Sec14l5 A G 16: 5,178,599 I470V possibly damaging Het
Serpinb1a T C 13: 32,842,859 T367A possibly damaging Het
Sirpb1a A G 3: 15,426,387 W7R probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Trim58 T C 11: 58,646,961 probably benign Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Zdhhc23 T A 16: 43,974,170 probably benign Het
Zfp407 G A 18: 84,208,746 A2246V probably damaging Het
Zfp872 C T 9: 22,200,454 R410* probably null Het
Other mutations in Fam89b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Fam89b APN 19 5729369 missense probably benign 0.00
IGL02323:Fam89b APN 19 5728871 unclassified probably null
R1475:Fam89b UTSW 19 5729419 missense probably damaging 0.98
R4770:Fam89b UTSW 19 5729454 missense probably damaging 0.98
R5393:Fam89b UTSW 19 5728705 missense probably damaging 1.00
R5408:Fam89b UTSW 19 5729393 nonsense probably null
R5427:Fam89b UTSW 19 5728791 missense probably benign
R6376:Fam89b UTSW 19 5728729 missense probably damaging 1.00
R7052:Fam89b UTSW 19 5729248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGACGGGAGATGCGATC -3'
(R):5'- TACTGAAGCGTTACCAGGGAG -3'

Sequencing Primer
(F):5'- TCGTCTCAGCTTCAGTCGGAG -3'
(R):5'- TTACCAGGGAGACGGTGGTAC -3'
Posted On2015-02-18