Incidental Mutation 'R3433:Cnot11'
ID266266
Institutional Source Beutler Lab
Gene Symbol Cnot11
Ensembl Gene ENSMUSG00000003135
Gene NameCCR4-NOT transcription complex, subunit 11
Synonyms2410015L18Rik, D1Bwg0212e
MMRRC Submission 040651-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39534992-39546889 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 39545187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003219] [ENSMUST00000161515] [ENSMUST00000195567]
Predicted Effect probably damaging
Transcript: ENSMUST00000003219
AA Change: R480Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003219
Gene: ENSMUSG00000003135
AA Change: R480Q

DomainStartEndE-ValueType
low complexity region 25 55 N/A INTRINSIC
low complexity region 62 73 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
Pfam:DUF2363 366 490 1.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160145
Predicted Effect probably damaging
Transcript: ENSMUST00000161515
AA Change: R480Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125638
Gene: ENSMUSG00000003135
AA Change: R480Q

DomainStartEndE-ValueType
low complexity region 25 55 N/A INTRINSIC
low complexity region 62 73 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
Pfam:DUF2363 366 491 3.3e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195567
SMART Domains Protein: ENSMUSP00000141388
Gene: ENSMUSG00000003135

DomainStartEndE-ValueType
Pfam:DUF2363 40 148 3.4e-44 PFAM
Meta Mutation Damage Score 0.7082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cd33 T C 7: 43,529,907 T273A probably benign Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kansl2 A G 15: 98,528,861 probably null Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rrbp1 A G 2: 143,952,280 probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Tnks1bp1 T C 2: 85,071,016 probably benign Het
Txndc11 T C 16: 11,088,188 T493A probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Zfp13 G A 17: 23,576,628 T323I probably damaging Het
Other mutations in Cnot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Cnot11 APN 1 39544883 splice site probably benign
R1087:Cnot11 UTSW 1 39540058 missense probably benign 0.18
R1398:Cnot11 UTSW 1 39545180 missense probably damaging 0.99
R4134:Cnot11 UTSW 1 39537548 missense probably benign 0.11
R4633:Cnot11 UTSW 1 39536218 missense probably benign 0.00
R5856:Cnot11 UTSW 1 39537453 missense probably benign 0.06
R6841:Cnot11 UTSW 1 39540067 nonsense probably null
R6931:Cnot11 UTSW 1 39539921 missense probably damaging 0.99
R7290:Cnot11 UTSW 1 39539939 nonsense probably null
RF007:Cnot11 UTSW 1 39542494 missense probably damaging 0.99
Z1177:Cnot11 UTSW 1 39535848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGTTGACCTACCTCCTG -3'
(R):5'- TTCATCCATGGGAAACATCTAGG -3'

Sequencing Primer
(F):5'- CCAATTGCATTTCTACTTGTGAACAG -3'
(R):5'- TCCATGGGAAACATCTAGGAAAAAG -3'
Posted On2015-02-18