Mutagenetix > Incidental Mutation

Incidental Mutation 'R3433:Catsperg2'

266296

Institutional Source

Beutler Lab

Gene Symbol

Catsperg2

Ensembl Gene

ENSMUSG00000049123

Gene Name

cation channel sperm associated auxiliary subunit gamma 2

Synonyms

1700067C01Rik, CATSPERG

MMRRC Submission

040651-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R3433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29697219-29727032 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29701218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 696 (F696S)

Ref Sequence

ENSEMBL: ENSMUSP00000147029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]

AlphaFold

C6KI89

Predicted Effect

probably benign
Transcript: ENSMUST00000061193
AA Change: F869S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: F869S

Domain	Start	End	E-Value	Type
Pfam:CATSPERG	2	973	N/A	PFAM
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1106	1118	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207115
AA Change: F696S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207483

Predicted Effect

probably benign
Transcript: ENSMUST00000208371
AA Change: F237S

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000208607

Predicted Effect

probably benign
Transcript: ENSMUST00000209126
AA Change: F869S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	A	7: 120,294,232	W1302R	probably damaging	Het
Abcf1	A	G	17: 35,958,217	Y689H	probably benign	Het
Adamtsl5	T	C	10: 80,342,891	T218A	probably benign	Het
Ahnak	G	T	19: 9,009,994	V2881L	probably benign	Het
Atp6v1b1	C	A	6: 83,743,092	T3K	possibly damaging	Het
Atp8b5	A	T	4: 43,372,697	R1112S	probably benign	Het
Carmil3	A	G	14: 55,507,694	D1331G	probably benign	Het
Cd33	T	C	7: 43,529,907	T273A	probably benign	Het
Cenpf	C	T	1: 189,659,949	C562Y	probably damaging	Het
Cep192	A	G	18: 67,834,892	R816G	probably benign	Het
Cnot11	G	A	1: 39,545,187		probably null	Het
Col18a1	A	G	10: 77,096,268	L329P	unknown	Het
Dnah9	T	C	11: 66,075,112	M1693V	possibly damaging	Het
Fbxo41	A	G	6: 85,477,631	I701T	probably damaging	Het
Figla	G	T	6: 86,017,429	R62L	probably damaging	Het
Gca	T	G	2: 62,689,974	S159R	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm10845	C	T	14: 79,863,411		noncoding transcript	Het
Gm5114	T	C	7: 39,409,197	K333E	probably benign	Het
Ift140	T	C	17: 25,036,308	I466T	probably benign	Het
Il6st	A	G	13: 112,503,831	K653E	probably damaging	Het
Kansl2	A	G	15: 98,528,861		probably null	Het
Kcnh7	T	C	2: 62,721,917	D910G	probably benign	Het
Leng8	C	A	7: 4,142,132	T177K	probably benign	Het
Lrrtm2	A	C	18: 35,213,897	S117R	probably damaging	Het
Megf8	G	T	7: 25,360,124	A2285S	probably benign	Het
Meiob	T	C	17: 24,816,597		probably benign	Het
Myo18a	G	T	11: 77,818,044		probably null	Het
Nars	A	T	18: 64,509,303	M156K	probably damaging	Het
Ndor1	A	G	2: 25,247,811	S499P	possibly damaging	Het
Olfr1251	T	C	2: 89,667,233	I218V	probably benign	Het
Olfr458	G	A	6: 42,460,954	H22Y	probably benign	Het
Olfr47	A	T	6: 43,235,673	I22F	probably damaging	Het
Pcdh15	T	G	10: 74,631,499	S1715A	probably benign	Het
Ptprd	C	A	4: 76,086,011		probably null	Het
Ros1	A	G	10: 52,091,108	Y1668H	probably benign	Het
Rrbp1	A	G	2: 143,952,280		probably benign	Het
Rtn4rl2	T	C	2: 84,872,100	Y376C	probably damaging	Het
Seh1l	A	C	18: 67,793,152	K358T	probably benign	Het
Sema3e	A	T	5: 14,252,714	Y751F	probably benign	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Spred2	G	T	11: 19,998,277	E91*	probably null	Het
Sspo	A	T	6: 48,475,951		probably null	Het
Tcaf1	A	G	6: 42,686,574	V124A	probably damaging	Het
Tnks1bp1	T	C	2: 85,071,016		probably benign	Het
Txndc11	T	C	16: 11,088,188	T493A	probably benign	Het
Usp17lb	T	A	7: 104,841,648	Q23L	possibly damaging	Het
Vgf	T	C	5: 137,031,019	F12L	probably benign	Het
Zfp13	G	A	17: 23,576,628	T323I	probably damaging	Het

Other mutations in Catsperg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Catsperg2	APN	7	29705404	missense	possibly damaging	0.86
IGL00095:Catsperg2	APN	7	29698058	missense	possibly damaging	0.73
IGL00902:Catsperg2	APN	7	29701143	missense	possibly damaging	0.93
IGL01667:Catsperg2	APN	7	29710133	missense	probably damaging	0.98
IGL01791:Catsperg2	APN	7	29704665	splice site	probably null
IGL01961:Catsperg2	APN	7	29721672	splice site	probably benign
IGL02187:Catsperg2	APN	7	29721366	missense	probably benign	0.02
IGL02605:Catsperg2	APN	7	29719565	missense	possibly damaging	0.71
IGL03001:Catsperg2	APN	7	29725079	missense	probably benign	0.32
IGL03228:Catsperg2	APN	7	29698225	missense	probably damaging	0.96
IGL03239:Catsperg2	APN	7	29697716	missense	probably benign	0.04
IGL03242:Catsperg2	APN	7	29725479	unclassified	probably benign
IGL03247:Catsperg2	APN	7	29717048	missense	possibly damaging	0.71
IGL03256:Catsperg2	APN	7	29709874	missense	probably damaging	0.99
PIT4520001:Catsperg2	UTSW	7	29710161	missense	possibly damaging	0.93
R0052:Catsperg2	UTSW	7	29725020	splice site	probably benign
R0281:Catsperg2	UTSW	7	29706571	missense	possibly damaging	0.86
R0357:Catsperg2	UTSW	7	29714901	missense	possibly damaging	0.93
R0480:Catsperg2	UTSW	7	29721298	missense	probably damaging	0.98
R0578:Catsperg2	UTSW	7	29704691	missense	possibly damaging	0.71
R0732:Catsperg2	UTSW	7	29700696	missense	probably damaging	1.00
R0826:Catsperg2	UTSW	7	29705624	missense	possibly damaging	0.92
R1535:Catsperg2	UTSW	7	29698246	missense	possibly damaging	0.85
R1925:Catsperg2	UTSW	7	29697764	missense	probably benign	0.01
R1990:Catsperg2	UTSW	7	29721045	nonsense	probably null
R3721:Catsperg2	UTSW	7	29705102	missense	probably benign	0.02
R4020:Catsperg2	UTSW	7	29717004	missense	probably damaging	0.99
R4760:Catsperg2	UTSW	7	29705635	missense	probably damaging	0.99
R4829:Catsperg2	UTSW	7	29701125	missense	probably damaging	0.98
R5033:Catsperg2	UTSW	7	29710134	missense	possibly damaging	0.93
R5093:Catsperg2	UTSW	7	29716998	missense	probably benign	0.32
R5266:Catsperg2	UTSW	7	29717066	missense	probably damaging	0.98
R5267:Catsperg2	UTSW	7	29717066	missense	probably damaging	0.98
R5287:Catsperg2	UTSW	7	29697838	missense	possibly damaging	0.96
R5427:Catsperg2	UTSW	7	29714850	missense	possibly damaging	0.71
R5575:Catsperg2	UTSW	7	29705590	missense	possibly damaging	0.84
R5685:Catsperg2	UTSW	7	29701188	missense	probably damaging	1.00
R5844:Catsperg2	UTSW	7	29697832	missense	possibly damaging	0.96
R5982:Catsperg2	UTSW	7	29713017	missense	possibly damaging	0.51
R6662:Catsperg2	UTSW	7	29719513	start gained	probably benign
R6744:Catsperg2	UTSW	7	29709819	missense	probably benign	0.23
R7171:Catsperg2	UTSW	7	29705325	missense	possibly damaging	0.71
R7239:Catsperg2	UTSW	7	29710082	missense	probably benign	0.00
R7336:Catsperg2	UTSW	7	29706601	missense	possibly damaging	0.83
R7498:Catsperg2	UTSW	7	29717102	missense	possibly damaging	0.71
R7548:Catsperg2	UTSW	7	29709826	missense	probably benign	0.32
R7562:Catsperg2	UTSW	7	29697719	missense	probably benign	0.18
R7565:Catsperg2	UTSW	7	29712981	missense	probably null	0.71
R7600:Catsperg2	UTSW	7	29704858	missense	probably benign	0.32
R8460:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8461:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8751:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8752:Catsperg2	UTSW	7	29705319	missense	possibly damaging	0.92
R8829:Catsperg2	UTSW	7	29697844	missense	probably benign	0.33
R8832:Catsperg2	UTSW	7	29697844	missense	probably benign	0.33
R9264:Catsperg2	UTSW	7	29698188	missense	possibly damaging	0.72
R9284:Catsperg2	UTSW	7	29705581	critical splice donor site	probably null
R9468:Catsperg2	UTSW	7	29710007	critical splice donor site	probably null
Z1177:Catsperg2	UTSW	7	29697782	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCACTAAATCTGAGAGAAGGGAT -3'
(R):5'- ACAGAGGAGTCTATCTCATAAACCAA -3'

Sequencing Primer
(F):5'- TGGAACACACAGTCGCG -3'
(R):5'- CTTCTGGCATGCAGGAGTACATAC -3'

Posted On

2015-02-18