Incidental Mutation 'R3433:Cd33'
ID 266298
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene Name CD33 molecule
Synonyms Siglec-3, gp67
MMRRC Submission 040651-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3433 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43176823-43186679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43179331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000146225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
AlphaFold Q63994
Predicted Effect probably benign
Transcript: ENSMUST00000004728
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609
AA Change: T273A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039861
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609
AA Change: T273A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205503
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205687
Predicted Effect probably benign
Transcript: ENSMUST00000206371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206977
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,893,455 (GRCm39) W1302R probably damaging Het
Abcf1 A G 17: 36,269,109 (GRCm39) Y689H probably benign Het
Adamtsl5 T C 10: 80,178,725 (GRCm39) T218A probably benign Het
Ahnak G T 19: 8,987,358 (GRCm39) V2881L probably benign Het
Atp6v1b1 C A 6: 83,720,074 (GRCm39) T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 (GRCm39) R1112S probably benign Het
Carmil3 A G 14: 55,745,151 (GRCm39) D1331G probably benign Het
Catsperg2 A G 7: 29,400,643 (GRCm39) F696S possibly damaging Het
Cenpf C T 1: 189,392,146 (GRCm39) C562Y probably damaging Het
Cep192 A G 18: 67,967,963 (GRCm39) R816G probably benign Het
Cnot11 G A 1: 39,584,268 (GRCm39) probably null Het
Col18a1 A G 10: 76,932,102 (GRCm39) L329P unknown Het
Dnah9 T C 11: 65,965,938 (GRCm39) M1693V possibly damaging Het
Fbxo41 A G 6: 85,454,613 (GRCm39) I701T probably damaging Het
Figla G T 6: 85,994,411 (GRCm39) R62L probably damaging Het
Gca T G 2: 62,520,318 (GRCm39) S159R probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm10845 C T 14: 80,100,851 (GRCm39) noncoding transcript Het
Gm5114 T C 7: 39,058,621 (GRCm39) K333E probably benign Het
Ift140 T C 17: 25,255,282 (GRCm39) I466T probably benign Het
Il6st A G 13: 112,640,365 (GRCm39) K653E probably damaging Het
Kansl2 A G 15: 98,426,742 (GRCm39) probably null Het
Kcnh7 T C 2: 62,552,261 (GRCm39) D910G probably benign Het
Leng8 C A 7: 4,145,131 (GRCm39) T177K probably benign Het
Lrrtm2 A C 18: 35,346,950 (GRCm39) S117R probably damaging Het
Megf8 G T 7: 25,059,549 (GRCm39) A2285S probably benign Het
Meiob T C 17: 25,035,571 (GRCm39) probably benign Het
Myo18a G T 11: 77,708,870 (GRCm39) probably null Het
Nars1 A T 18: 64,642,374 (GRCm39) M156K probably damaging Het
Ndor1 A G 2: 25,137,823 (GRCm39) S499P possibly damaging Het
Or2a57 A T 6: 43,212,607 (GRCm39) I22F probably damaging Het
Or2r11 G A 6: 42,437,888 (GRCm39) H22Y probably benign Het
Or4a78 T C 2: 89,497,577 (GRCm39) I218V probably benign Het
Pcdh15 T G 10: 74,467,331 (GRCm39) S1715A probably benign Het
Ptprd C A 4: 76,004,248 (GRCm39) probably null Het
Ros1 A G 10: 51,967,204 (GRCm39) Y1668H probably benign Het
Rrbp1 A G 2: 143,794,200 (GRCm39) probably benign Het
Rtn4rl2 T C 2: 84,702,444 (GRCm39) Y376C probably damaging Het
Seh1l A C 18: 67,926,222 (GRCm39) K358T probably benign Het
Sema3e A T 5: 14,302,728 (GRCm39) Y751F probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spred2 G T 11: 19,948,277 (GRCm39) E91* probably null Het
Sspo A T 6: 48,452,885 (GRCm39) probably null Het
Tcaf1 A G 6: 42,663,508 (GRCm39) V124A probably damaging Het
Tnks1bp1 T C 2: 84,901,360 (GRCm39) probably benign Het
Txndc11 T C 16: 10,906,052 (GRCm39) T493A probably benign Het
Usp17lb T A 7: 104,490,855 (GRCm39) Q23L possibly damaging Het
Vgf T C 5: 137,059,873 (GRCm39) F12L probably benign Het
Zfp13 G A 17: 23,795,602 (GRCm39) T323I probably damaging Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43,178,982 (GRCm39) intron probably benign
IGL01025:Cd33 APN 7 43,182,329 (GRCm39) missense probably damaging 1.00
IGL01593:Cd33 APN 7 43,179,705 (GRCm39) missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43,178,274 (GRCm39) utr 3 prime probably benign
IGL02519:Cd33 APN 7 43,178,153 (GRCm39) utr 3 prime probably benign
IGL02626:Cd33 APN 7 43,179,736 (GRCm39) splice site probably benign
1mM(1):Cd33 UTSW 7 43,178,217 (GRCm39) utr 3 prime probably benign
R0751:Cd33 UTSW 7 43,181,545 (GRCm39) missense probably damaging 1.00
R1513:Cd33 UTSW 7 43,181,618 (GRCm39) missense probably damaging 1.00
R1542:Cd33 UTSW 7 43,181,530 (GRCm39) missense probably damaging 1.00
R1752:Cd33 UTSW 7 43,181,722 (GRCm39) missense probably benign 0.24
R1928:Cd33 UTSW 7 43,179,303 (GRCm39) missense probably benign 0.41
R2045:Cd33 UTSW 7 43,179,316 (GRCm39) missense probably benign 0.00
R2127:Cd33 UTSW 7 43,179,699 (GRCm39) missense possibly damaging 0.72
R4760:Cd33 UTSW 7 43,178,919 (GRCm39) missense probably benign
R4810:Cd33 UTSW 7 43,182,134 (GRCm39) missense probably damaging 0.99
R5387:Cd33 UTSW 7 43,181,477 (GRCm39) nonsense probably null
R5611:Cd33 UTSW 7 43,181,542 (GRCm39) missense probably damaging 0.97
R5796:Cd33 UTSW 7 43,182,480 (GRCm39) critical splice donor site probably null
R8021:Cd33 UTSW 7 43,178,262 (GRCm39) missense unknown
R8193:Cd33 UTSW 7 43,181,696 (GRCm39) missense possibly damaging 0.96
R8993:Cd33 UTSW 7 43,182,871 (GRCm39) unclassified probably benign
R9495:Cd33 UTSW 7 43,182,150 (GRCm39) missense probably benign 0.09
R9514:Cd33 UTSW 7 43,182,150 (GRCm39) missense probably benign 0.09
R9590:Cd33 UTSW 7 43,179,637 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGAAGAGTGGCTACGTG -3'
(R):5'- CTCTGGTGCATGTAGTGACC -3'

Sequencing Primer
(F):5'- TCCATACTGGACTCTACACAGAGATG -3'
(R):5'- TGACCGATTCACTTCAACAATGAGG -3'
Posted On 2015-02-18