Incidental Mutation 'R3433:Cd33'
ID266298
Institutional Source Beutler Lab
Gene Symbol Cd33
Ensembl Gene ENSMUSG00000004609
Gene NameCD33 antigen
SynonymsSiglec-3, gp67
MMRRC Submission 040651-MU
Accession Numbers

Genbank: NM_001111058.1, NM_021293.3; Ensembl: ENSMUST00000004728, ENSMUST00000039861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43524216-43544428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43529907 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000146225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004728] [ENSMUST00000039861] [ENSMUST00000205503]
Predicted Effect probably benign
Transcript: ENSMUST00000004728
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000004728
Gene: ENSMUSG00000004609
AA Change: T273A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039861
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000045458
Gene: ENSMUSG00000004609
AA Change: T273A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 26 139 2.58e-6 SMART
IG_like 148 232 2.66e1 SMART
transmembrane domain 242 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205503
AA Change: T273A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205687
Predicted Effect probably benign
Transcript: ENSMUST00000206371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206977
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene show slight reductions in mean erythrocyte count and hematocrit and increased concentration of blood aspartate aminotransaminase. There is also a hyporesponsiveness to induced peritonitis and a weaker IL-6 response to LPS-induced systemic inflammation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Cnot11 G A 1: 39,545,187 probably null Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kansl2 A G 15: 98,528,861 probably null Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rrbp1 A G 2: 143,952,280 probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Tnks1bp1 T C 2: 85,071,016 probably benign Het
Txndc11 T C 16: 11,088,188 T493A probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Zfp13 G A 17: 23,576,628 T323I probably damaging Het
Other mutations in Cd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Cd33 APN 7 43529558 intron probably benign
IGL01025:Cd33 APN 7 43532905 missense probably damaging 1.00
IGL01593:Cd33 APN 7 43530281 missense possibly damaging 0.91
IGL02080:Cd33 APN 7 43528850 utr 3 prime probably benign
IGL02519:Cd33 APN 7 43528729 utr 3 prime probably benign
IGL02626:Cd33 APN 7 43530312 splice site probably benign
1mM(1):Cd33 UTSW 7 43528793 utr 3 prime probably benign
R0751:Cd33 UTSW 7 43532121 missense probably damaging 1.00
R1513:Cd33 UTSW 7 43532194 missense probably damaging 1.00
R1542:Cd33 UTSW 7 43532106 missense probably damaging 1.00
R1752:Cd33 UTSW 7 43532298 missense probably benign 0.24
R1928:Cd33 UTSW 7 43529879 missense probably benign 0.41
R2045:Cd33 UTSW 7 43529892 missense probably benign 0.00
R2127:Cd33 UTSW 7 43530275 missense possibly damaging 0.72
R4760:Cd33 UTSW 7 43529495 missense probably benign
R4810:Cd33 UTSW 7 43532710 missense probably damaging 0.99
R5387:Cd33 UTSW 7 43532053 nonsense probably null
R5611:Cd33 UTSW 7 43532118 missense probably damaging 0.97
R5796:Cd33 UTSW 7 43533056 critical splice donor site probably null
R8021:Cd33 UTSW 7 43528838 missense unknown
R8193:Cd33 UTSW 7 43532272 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAGAAGAGTGGCTACGTG -3'
(R):5'- CTCTGGTGCATGTAGTGACC -3'

Sequencing Primer
(F):5'- TCCATACTGGACTCTACACAGAGATG -3'
(R):5'- TGACCGATTCACTTCAACAATGAGG -3'
Posted On2015-02-18