Incidental Mutation 'R3433:Kansl2'
ID266311
Institutional Source Beutler Lab
Gene Symbol Kansl2
Ensembl Gene ENSMUSG00000022992
Gene NameKAT8 regulatory NSL complex subunit 2
Synonyms2310037I24Rik
MMRRC Submission 040651-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98517658-98534264 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 98528861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023727] [ENSMUST00000116400] [ENSMUST00000230542] [ENSMUST00000231066]
Predicted Effect probably null
Transcript: ENSMUST00000023727
SMART Domains Protein: ENSMUSP00000023727
Gene: ENSMUSG00000022992

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 27 93 4.8e-19 PFAM
Pfam:zf-C3Hc3H 300 365 4.6e-19 PFAM
low complexity region 408 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084005
Predicted Effect probably null
Transcript: ENSMUST00000116400
SMART Domains Protein: ENSMUSP00000112101
Gene: ENSMUSG00000022992

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 28 92 1e-19 PFAM
Pfam:zf-C3Hc3H 302 364 1.7e-16 PFAM
low complexity region 442 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229818
Predicted Effect probably null
Transcript: ENSMUST00000230542
Predicted Effect probably benign
Transcript: ENSMUST00000231066
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cd33 T C 7: 43,529,907 T273A probably benign Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Cnot11 G A 1: 39,545,187 probably null Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rrbp1 A G 2: 143,952,280 probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Tnks1bp1 T C 2: 85,071,016 probably benign Het
Txndc11 T C 16: 11,088,188 T493A probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Zfp13 G A 17: 23,576,628 T323I probably damaging Het
Other mutations in Kansl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Kansl2 APN 15 98528853 splice site probably benign
IGL02167:Kansl2 APN 15 98533515 splice site probably benign
IGL02349:Kansl2 APN 15 98529446 missense probably damaging 1.00
R0004:Kansl2 UTSW 15 98520376 missense probably damaging 1.00
R1128:Kansl2 UTSW 15 98533685 nonsense probably null
R1129:Kansl2 UTSW 15 98533581 missense probably damaging 1.00
R1311:Kansl2 UTSW 15 98528916 missense possibly damaging 0.93
R2132:Kansl2 UTSW 15 98529397 missense probably damaging 1.00
R2144:Kansl2 UTSW 15 98526631 missense probably benign 0.00
R2232:Kansl2 UTSW 15 98524478 missense probably damaging 1.00
R2510:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R4125:Kansl2 UTSW 15 98531755 missense possibly damaging 0.79
R4818:Kansl2 UTSW 15 98526661 missense possibly damaging 0.48
R4906:Kansl2 UTSW 15 98531890 missense possibly damaging 0.83
R4962:Kansl2 UTSW 15 98531843 missense probably benign 0.01
R5973:Kansl2 UTSW 15 98529425 missense probably damaging 1.00
R6014:Kansl2 UTSW 15 98520316 critical splice donor site probably null
R6077:Kansl2 UTSW 15 98531431 missense probably benign 0.08
R6657:Kansl2 UTSW 15 98524670 missense possibly damaging 0.67
R7168:Kansl2 UTSW 15 98529544 splice site probably null
R7418:Kansl2 UTSW 15 98531894 missense possibly damaging 0.95
R7530:Kansl2 UTSW 15 98529015 missense probably benign 0.01
R7957:Kansl2 UTSW 15 98524618 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAAGCCAGAACTGCTCGTG -3'
(R):5'- AGCCTTTCTAATGGTGACTGTG -3'

Sequencing Primer
(F):5'- AGACAAGAGTTCCTCTGTGTAGCC -3'
(R):5'- CCTATCCAGTACTTGAGAAGCTGAG -3'
Posted On2015-02-18