Incidental Mutation 'R3433:Txndc11'
ID266312
Institutional Source Beutler Lab
Gene Symbol Txndc11
Ensembl Gene ENSMUSG00000022498
Gene Namethioredoxin domain containing 11
Synonyms2810408E11Rik, EF-hand binding protein 1, Txdc11, EFP1
MMRRC Submission 040651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11074911-11134650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11088188 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 493 (T493A)
Ref Sequence ENSEMBL: ENSMUSP00000113432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038424] [ENSMUST00000118362] [ENSMUST00000145225]
Predicted Effect probably benign
Transcript: ENSMUST00000038424
AA Change: T493A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041113
Gene: ENSMUSG00000022498
AA Change: T493A

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.8e-11 PFAM
Pfam:Thioredoxin 660 756 1e-11 PFAM
coiled coil region 793 830 N/A INTRINSIC
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118362
AA Change: T493A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113432
Gene: ENSMUSG00000022498
AA Change: T493A

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 2.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131012
Predicted Effect probably benign
Transcript: ENSMUST00000145225
SMART Domains Protein: ENSMUSP00000116563
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148183
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cd33 T C 7: 43,529,907 T273A probably benign Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Cnot11 G A 1: 39,545,187 probably null Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kansl2 A G 15: 98,528,861 probably null Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rrbp1 A G 2: 143,952,280 probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Tnks1bp1 T C 2: 85,071,016 probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Zfp13 G A 17: 23,576,628 T323I probably damaging Het
Other mutations in Txndc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL00563:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL02576:Txndc11 APN 16 11075017 unclassified probably benign
IGL03070:Txndc11 APN 16 11075287 missense probably damaging 0.97
P0047:Txndc11 UTSW 16 11091797 splice site probably benign
R0091:Txndc11 UTSW 16 11088104 missense probably benign
R0448:Txndc11 UTSW 16 11091761 missense probably damaging 0.99
R0796:Txndc11 UTSW 16 11134474 small deletion probably benign
R0960:Txndc11 UTSW 16 11091589 missense probably benign 0.28
R1184:Txndc11 UTSW 16 11128500 missense probably benign 0.03
R1327:Txndc11 UTSW 16 11116814 missense possibly damaging 0.86
R1441:Txndc11 UTSW 16 11134550 start gained probably benign
R1515:Txndc11 UTSW 16 11075062 missense probably damaging 0.98
R1699:Txndc11 UTSW 16 11087775 critical splice donor site probably null
R1709:Txndc11 UTSW 16 11128701 nonsense probably null
R1850:Txndc11 UTSW 16 11088404 missense probably damaging 0.98
R2026:Txndc11 UTSW 16 11134474 small deletion probably benign
R4468:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4469:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4652:Txndc11 UTSW 16 11075122 missense probably benign
R4675:Txndc11 UTSW 16 11084881 missense possibly damaging 0.65
R4697:Txndc11 UTSW 16 11084314 missense probably damaging 0.99
R4907:Txndc11 UTSW 16 11088534 missense probably benign 0.17
R5205:Txndc11 UTSW 16 11128665 missense probably damaging 0.98
R5273:Txndc11 UTSW 16 11128623 missense probably benign 0.07
R5865:Txndc11 UTSW 16 11122688 missense probably damaging 1.00
R5873:Txndc11 UTSW 16 11075205 missense probably damaging 1.00
R5941:Txndc11 UTSW 16 11075071 missense probably benign 0.04
R6360:Txndc11 UTSW 16 11084792 missense probably damaging 1.00
R6894:Txndc11 UTSW 16 11088145 missense probably damaging 1.00
R7285:Txndc11 UTSW 16 11084299 missense probably damaging 0.98
R7334:Txndc11 UTSW 16 11128561 missense probably damaging 1.00
R7502:Txndc11 UTSW 16 11087878 missense probably benign 0.08
R7660:Txndc11 UTSW 16 11087929 missense probably damaging 1.00
R7677:Txndc11 UTSW 16 11134474 small deletion probably benign
R7683:Txndc11 UTSW 16 11084235 missense probably damaging 1.00
R8315:Txndc11 UTSW 16 11075601 missense possibly damaging 0.70
X0020:Txndc11 UTSW 16 11084218 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCAATGTGAGGAATGGAGCTC -3'
(R):5'- TCACTGCCTGATACTCAGCTG -3'

Sequencing Primer
(F):5'- ATGGAGCTCGGGGCAGTG -3'
(R):5'- CTGATACTCAGCTGATGGCAG -3'
Posted On2015-02-18