Incidental Mutation 'R3433:Zfp13'
ID266313
Institutional Source Beutler Lab
Gene Symbol Zfp13
Ensembl Gene ENSMUSG00000062012
Gene Namezinc finger protein 13
SynonymsZfp-13, Krox-8
MMRRC Submission 040651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23575844-23599487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23576628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 323 (T323I)
Ref Sequence ENSEMBL: ENSMUSP00000111178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057029] [ENSMUST00000115516] [ENSMUST00000227952]
Predicted Effect probably benign
Transcript: ENSMUST00000057029
AA Change: T316I

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054595
Gene: ENSMUSG00000062012
AA Change: T316I

DomainStartEndE-ValueType
KRAB 117 179 7.54e-10 SMART
ZnF_C2H2 259 281 7.37e-4 SMART
ZnF_C2H2 287 309 1.2e-3 SMART
ZnF_C2H2 315 337 5.9e-3 SMART
ZnF_C2H2 343 365 1.26e-2 SMART
ZnF_C2H2 371 393 9.73e-4 SMART
ZnF_C2H2 399 421 2.12e-4 SMART
ZnF_C2H2 427 449 1.18e-2 SMART
ZnF_C2H2 455 477 6.52e-5 SMART
low complexity region 480 503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115516
AA Change: T323I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111178
Gene: ENSMUSG00000062012
AA Change: T323I

DomainStartEndE-ValueType
KRAB 124 186 7.54e-10 SMART
ZnF_C2H2 266 288 7.37e-4 SMART
ZnF_C2H2 294 316 1.2e-3 SMART
ZnF_C2H2 322 344 5.9e-3 SMART
ZnF_C2H2 350 372 1.26e-2 SMART
ZnF_C2H2 378 400 9.73e-4 SMART
ZnF_C2H2 406 428 2.12e-4 SMART
ZnF_C2H2 434 456 1.18e-2 SMART
ZnF_C2H2 462 484 6.52e-5 SMART
low complexity region 487 510 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226550
Predicted Effect probably benign
Transcript: ENSMUST00000227952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228942
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cd33 T C 7: 43,529,907 T273A probably benign Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Cnot11 G A 1: 39,545,187 probably null Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kansl2 A G 15: 98,528,861 probably null Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rrbp1 A G 2: 143,952,280 probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Tnks1bp1 T C 2: 85,071,016 probably benign Het
Txndc11 T C 16: 11,088,188 T493A probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Other mutations in Zfp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02236:Zfp13 APN 17 23580765 splice site probably benign
IGL02447:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02449:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02450:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02466:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02468:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02471:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02473:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02474:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02475:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02491:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02511:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL02558:Zfp13 APN 17 23576098 missense probably benign 0.05
IGL03030:Zfp13 APN 17 23580845 missense probably benign 0.01
IGL03388:Zfp13 APN 17 23576914 missense probably benign 0.00
R0053:Zfp13 UTSW 17 23576148 missense probably damaging 1.00
R0053:Zfp13 UTSW 17 23576148 missense probably damaging 1.00
R1514:Zfp13 UTSW 17 23576412 missense probably damaging 1.00
R2420:Zfp13 UTSW 17 23576212 missense probably damaging 1.00
R4458:Zfp13 UTSW 17 23581176 missense probably benign 0.01
R4650:Zfp13 UTSW 17 23580138 missense probably damaging 1.00
R4824:Zfp13 UTSW 17 23576823 missense possibly damaging 0.95
R5088:Zfp13 UTSW 17 23577061 nonsense probably null
R5110:Zfp13 UTSW 17 23580860 missense probably benign 0.02
R5384:Zfp13 UTSW 17 23581182 missense probably damaging 1.00
R7302:Zfp13 UTSW 17 23581062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCGATGAGATTGGAGC -3'
(R):5'- CATACAAGTGCGAGCAGTGTG -3'

Sequencing Primer
(F):5'- CTCTGGGTGAAGCACTTGC -3'
(R):5'- CAGTGTGGCAAGGGCTTCAG -3'
Posted On2015-02-18