Incidental Mutation 'R3434:Adora3'
ID266330
Institutional Source Beutler Lab
Gene Symbol Adora3
Ensembl Gene ENSMUSG00000000562
Gene Nameadenosine A3 receptor
SynonymsAA3R, ARA3, A3AR, 4930578J19Rik, A3R, Gpcr 2, 1700001D09Rik
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105870858-105908926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105904915 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 39 (K39R)
Ref Sequence ENSEMBL: ENSMUSP00000143674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000574] [ENSMUST00000010279] [ENSMUST00000164730] [ENSMUST00000196748] [ENSMUST00000200482]
Predicted Effect probably benign
Transcript: ENSMUST00000000574
AA Change: K39R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000000574
Gene: ENSMUSG00000000562
AA Change: K39R

DomainStartEndE-ValueType
Pfam:7tm_4 21 301 3.5e-12 PFAM
Pfam:7TM_GPCR_Srsx 24 298 5e-12 PFAM
Pfam:7tm_1 30 283 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010279
SMART Domains Protein: ENSMUSP00000010279
Gene: ENSMUSG00000074344

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IG 20 115 3.94e0 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164730
SMART Domains Protein: ENSMUSP00000126710
Gene: ENSMUSG00000000562

DomainStartEndE-ValueType
Pfam:7tm_1 1 137 6.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196748
AA Change: K39R

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143674
Gene: ENSMUSG00000074344
AA Change: K39R

DomainStartEndE-ValueType
Pfam:7tm_4 21 131 7.3e-9 PFAM
Pfam:7TM_GPCR_Srsx 24 123 1.3e-7 PFAM
Pfam:7tm_1 30 129 2.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197613
Predicted Effect probably benign
Transcript: ENSMUST00000200482
SMART Domains Protein: ENSMUSP00000142695
Gene: ENSMUSG00000074344

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IG 20 115 1.6e-2 SMART
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the family of adenosine receptors, which are G-protein-coupled receptors that are involved in a variety of intracellular signaling pathways and physiological functions. The receptor encoded by this gene mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death. This gene shares its 3' terminal exon with a transcript variant from overlapping GeneID:69296, which encodes an immunoglobulin domain-containing protein. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are phenotypically indistinguishable from wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Adora3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Adora3 APN 3 105907812 missense probably benign 0.02
IGL03210:Adora3 APN 3 105907860 missense probably benign 0.01
R1885:Adora3 UTSW 3 105904836 missense possibly damaging 0.80
R1886:Adora3 UTSW 3 105904836 missense possibly damaging 0.80
R1887:Adora3 UTSW 3 105904836 missense possibly damaging 0.80
R4864:Adora3 UTSW 3 105907815 missense probably damaging 1.00
R5328:Adora3 UTSW 3 105907303 missense probably benign 0.00
R5746:Adora3 UTSW 3 105907810 missense possibly damaging 0.49
R6322:Adora3 UTSW 3 105907444 missense probably benign 0.10
R6432:Adora3 UTSW 3 105907675 nonsense probably null
R7264:Adora3 UTSW 3 105904825 missense probably benign 0.02
R7772:Adora3 UTSW 3 105907723 missense probably benign
Z1177:Adora3 UTSW 3 105907785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGACAAGAGCTGGGTC -3'
(R):5'- CTACAGCAATGGCCAGCAAG -3'

Sequencing Primer
(F):5'- TGACAAGAGCTGGGTCCACTG -3'
(R):5'- CATGATGGAAGCATGGGTGAAGATC -3'
Posted On2015-02-18