Incidental Mutation 'R3434:Epb41l4b'
ID266334
Institutional Source Beutler Lab
Gene Symbol Epb41l4b
Ensembl Gene ENSMUSG00000028434
Gene Nameerythrocyte membrane protein band 4.1 like 4b
Synonyms6430543G08Rik, D4Ertd346e, Lulu2, Epb4.1l4b, Ehm2
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56991972-57143437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57040865 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 533 (N533D)
Ref Sequence ENSEMBL: ENSMUSP00000092687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095076]
Predicted Effect probably benign
Transcript: ENSMUST00000095076
AA Change: N533D

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092687
Gene: ENSMUSG00000028434
AA Change: N533D

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
low complexity region 504 513 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Epb41l4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Epb41l4b APN 4 57103422 critical splice donor site probably null
IGL02311:Epb41l4b APN 4 57076456 missense probably damaging 1.00
Episode UTSW 4 57142866 missense probably benign 0.00
R0456:Epb41l4b UTSW 4 57142843 splice site probably null
R0799:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R0905:Epb41l4b UTSW 4 57103528 missense probably damaging 1.00
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1506:Epb41l4b UTSW 4 57088824 missense probably damaging 1.00
R1618:Epb41l4b UTSW 4 57032204 missense probably benign 0.00
R1919:Epb41l4b UTSW 4 57040993 missense probably damaging 0.99
R1956:Epb41l4b UTSW 4 57038553 missense possibly damaging 0.94
R2041:Epb41l4b UTSW 4 57084070 missense probably damaging 0.98
R2048:Epb41l4b UTSW 4 57142866 missense probably benign 0.00
R4059:Epb41l4b UTSW 4 57024337 critical splice donor site probably null
R4175:Epb41l4b UTSW 4 57076556 missense probably damaging 1.00
R4694:Epb41l4b UTSW 4 57019875 missense probably benign 0.01
R4817:Epb41l4b UTSW 4 57103428 missense probably damaging 1.00
R5076:Epb41l4b UTSW 4 57040984 missense probably damaging 1.00
R5179:Epb41l4b UTSW 4 57063181 missense probably benign 0.01
R5246:Epb41l4b UTSW 4 57040989 missense probably damaging 0.99
R5530:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R5579:Epb41l4b UTSW 4 57064802 missense possibly damaging 0.62
R5784:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R6772:Epb41l4b UTSW 4 57063140 missense probably benign
R6965:Epb41l4b UTSW 4 57040915 missense probably damaging 1.00
R7045:Epb41l4b UTSW 4 57103522 missense possibly damaging 0.94
R7316:Epb41l4b UTSW 4 57019867 missense probably benign 0.01
R7750:Epb41l4b UTSW 4 57076913 critical splice donor site probably null
Z1177:Epb41l4b UTSW 4 57063191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTGGCCATTTATAACATGGAAG -3'
(R):5'- GACTTTGTTGCCTGCCTCAG -3'

Sequencing Primer
(F):5'- GCAGGAAACCACTGAGTCTAGATC -3'
(R):5'- GTTGCCTGCCTCAGCTACC -3'
Posted On2015-02-18