Mutagenetix > Incidental Mutation

Incidental Mutation 'R3434:Rsbn1l'

266340

Institutional Source

Beutler Lab

Gene Symbol

Rsbn1l

Ensembl Gene

ENSMUSG00000039968

Gene Name

round spermatid basic protein 1-like

Synonyms

C330002G24Rik, 8430412F05Rik

MMRRC Submission

040652-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R3434 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

20893028-20956398 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 20905930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036489] [ENSMUST00000196780]

AlphaFold

D3Z0K6

Predicted Effect

probably benign
Transcript: ENSMUST00000036489

SMART Domains

Protein: ENSMUSP00000039482
Gene: ENSMUSG00000039968

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
low complexity region	71	109	N/A	INTRINSIC
low complexity region	136	156	N/A	INTRINSIC
low complexity region	176	194	N/A	INTRINSIC
low complexity region	229	249	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196780

SMART Domains

Protein: ENSMUSP00000142789
Gene: ENSMUSG00000039968

Domain	Start	End	E-Value	Type
low complexity region	52	62	N/A	INTRINSIC
low complexity region	71	109	N/A	INTRINSIC
low complexity region	136	156	N/A	INTRINSIC
low complexity region	176	194	N/A	INTRINSIC
low complexity region	229	249	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Rsbn1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Rsbn1l	APN	5	20896155	missense	probably benign	0.08
IGL01631:Rsbn1l	APN	5	20896571	missense	probably damaging	1.00
IGL01631:Rsbn1l	APN	5	20896572	missense	probably damaging	1.00
IGL02237:Rsbn1l	APN	5	20919606	missense	probably benign	0.39
IGL02434:Rsbn1l	APN	5	20919734	missense	probably damaging	0.99
IGL02458:Rsbn1l	APN	5	20951736	missense	probably damaging	0.99
IGL02994:Rsbn1l	APN	5	20908234	missense	probably damaging	1.00
PIT4280001:Rsbn1l	UTSW	5	20919655	missense	probably damaging	1.00
R0288:Rsbn1l	UTSW	5	20920040	missense	probably damaging	0.97
R1429:Rsbn1l	UTSW	5	20920018	missense	probably damaging	1.00
R1524:Rsbn1l	UTSW	5	20951673	missense	probably damaging	1.00
R1713:Rsbn1l	UTSW	5	20951490	missense	probably benign	0.18
R1875:Rsbn1l	UTSW	5	20951698	missense	probably benign	0.17
R1998:Rsbn1l	UTSW	5	20902370	missense	probably damaging	1.00
R1999:Rsbn1l	UTSW	5	20902370	missense	probably damaging	1.00
R2000:Rsbn1l	UTSW	5	20902370	missense	probably damaging	1.00
R2504:Rsbn1l	UTSW	5	20902366	missense	probably damaging	1.00
R2566:Rsbn1l	UTSW	5	20919769	missense	probably benign	0.40
R3789:Rsbn1l	UTSW	5	20896108	missense	probably benign	0.24
R3893:Rsbn1l	UTSW	5	20905840	missense	probably damaging	1.00
R3924:Rsbn1l	UTSW	5	20919787	missense	probably damaging	1.00
R4335:Rsbn1l	UTSW	5	20908193	missense	probably null	0.45
R4422:Rsbn1l	UTSW	5	20896546	missense	probably damaging	1.00
R5131:Rsbn1l	UTSW	5	20896245	missense	possibly damaging	0.89
R5212:Rsbn1l	UTSW	5	20896214	missense	probably benign	0.03
R5739:Rsbn1l	UTSW	5	20905816	missense	probably damaging	1.00
R6736:Rsbn1l	UTSW	5	20908224	missense	probably benign	0.45
R6980:Rsbn1l	UTSW	5	20896484	missense	probably benign
R7252:Rsbn1l	UTSW	5	20908198	missense	probably damaging	1.00
R7443:Rsbn1l	UTSW	5	20927623	missense	possibly damaging	0.61
R7538:Rsbn1l	UTSW	5	20896457	missense	probably benign	0.01
R7914:Rsbn1l	UTSW	5	20905898	missense	probably damaging	1.00
R8396:Rsbn1l	UTSW	5	20927667	missense	probably benign	0.40
R8899:Rsbn1l	UTSW	5	20896867	missense	probably damaging	1.00
R8941:Rsbn1l	UTSW	5	20905843	missense	probably damaging	1.00
R9472:Rsbn1l	UTSW	5	20908121	missense	probably damaging	0.98
R9723:Rsbn1l	UTSW	5	20896466	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- CGCCAAGTCCATCCTCACTG -3'
(R):5'- CCCACGAGATCTTCTGAGCTG -3'

Sequencing Primer
(F):5'- GTCCATCCTCACTGATAAAGATGTG -3'
(R):5'- CACGAGATCTTCTGAGCTGAACTG -3'

Posted On

2015-02-18