Mutagenetix > Incidental Mutations

Incidental Mutation 'R3434:Sel1l3'

266341

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

040652-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53107083-53213927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53117090 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1016 (D1016G)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

Predicted Effect

probably benign
Transcript: ENSMUST00000031090
AA Change: D1016G

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: D1016G

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Meta Mutation Damage Score

0.0956

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53116333	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53154236	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53200168	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53121841	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53200143	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53200338	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53145493	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53170405	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53139799	splice site	probably benign
IGL02930:Sel1l3	APN	5	53123217	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53154243	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53121857	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53144037	splice site	probably benign
R1027:Sel1l3	UTSW	5	53145478	missense	possibly damaging	0.68
R1117:Sel1l3	UTSW	5	53172607	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53137929	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53145545	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53170447	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R4043:Sel1l3	UTSW	5	53188054	nonsense	probably null
R4074:Sel1l3	UTSW	5	53154287	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53144183	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53131833	missense	probably benign	0.41
R4900:Sel1l3	UTSW	5	53131842	missense	probably damaging	1.00
R5000:Sel1l3	UTSW	5	53200434	missense	probably damaging	0.97
R5090:Sel1l3	UTSW	5	53200046	missense	probably benign	0.03
R5330:Sel1l3	UTSW	5	53186009	missense	possibly damaging	0.80
R5456:Sel1l3	UTSW	5	53200036	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53200302	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53184808	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53200189	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53155719	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53139860	missense	probably damaging	0.98
R7015:Sel1l3	UTSW	5	53172574	missense	probably benign	0.03
R7200:Sel1l3	UTSW	5	53144109	missense	probably benign	0.22
R7271:Sel1l3	UTSW	5	53116362	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53116409	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53117120	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53185984	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53123162	splice site	probably null
R7741:Sel1l3	UTSW	5	53200251	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53135885	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53144064	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53139824	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53187954	critical splice donor site	probably null
R8724:Sel1l3	UTSW	5	53135823	nonsense	probably null
R8788:Sel1l3	UTSW	5	53174806	nonsense	probably null
Z1088:Sel1l3	UTSW	5	53116196	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGAAGAGCACCTGGGCTTAG -3'
(R):5'- ACTGGGTTTTATATCCCAGCAG -3'

Sequencing Primer
(F):5'- GCTTAGCTGAAGGTTCTCTAACAG -3'
(R):5'- ATATCCCAGCAGTTACTGAGCTTGG -3'

Posted On

2015-02-18