Incidental Mutation 'R3434:Ppat'
ID266342
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Namephosphoribosyl pyrophosphate amidotransferase
Synonyms
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76913249-76951578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76918065 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 402 (I402T)
Ref Sequence ENSEMBL: ENSMUSP00000120632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031158
Predicted Effect probably damaging
Transcript: ENSMUST00000140076
AA Change: I402T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246
AA Change: I402T

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 76915232 missense probably damaging 1.00
IGL02679:Ppat APN 5 76919469 missense probably benign 0.10
R0836:Ppat UTSW 5 76922501 missense probably benign 0.09
R2327:Ppat UTSW 5 76922467 missense possibly damaging 0.94
R2850:Ppat UTSW 5 76919375 missense probably benign
R4301:Ppat UTSW 5 76928501 intron probably benign
R4422:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4423:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4424:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4839:Ppat UTSW 5 76950964 nonsense probably null
R4872:Ppat UTSW 5 76926793 missense probably damaging 0.99
R5007:Ppat UTSW 5 76928678 intron probably benign
R5010:Ppat UTSW 5 76928678 intron probably benign
R5325:Ppat UTSW 5 76928422 intron probably benign
R5982:Ppat UTSW 5 76915265 missense probably benign
R6209:Ppat UTSW 5 76918146 missense probably benign 0.00
R6225:Ppat UTSW 5 76922355 missense probably damaging 0.99
R6287:Ppat UTSW 5 76918214 nonsense probably null
R7367:Ppat UTSW 5 76919864 nonsense probably null
R7426:Ppat UTSW 5 76915979 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTAGTTAGCACATGTTTTCCC -3'
(R):5'- GGCCAATATTGCTACTAATGTGC -3'

Sequencing Primer
(F):5'- CTATTGCTGCCCAACTATCATAGAG -3'
(R):5'- GATTTCCCCTCCATCAGTGTGGG -3'
Posted On2015-02-18