Incidental Mutation 'R3434:P2rx4'
ID266344
Institutional Source Beutler Lab
Gene Symbol P2rx4
Ensembl Gene ENSMUSG00000029470
Gene Namepurinergic receptor P2X, ligand-gated ion channel 4
SynonymsD5Ertd444e, P2X4
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122707544-122729738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122725070 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 202 (I202K)
Ref Sequence ENSEMBL: ENSMUSP00000118163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031429] [ENSMUST00000081554] [ENSMUST00000139631] [ENSMUST00000142664] [ENSMUST00000198560]
Predicted Effect probably damaging
Transcript: ENSMUST00000031429
AA Change: I229K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031429
Gene: ENSMUSG00000029470
AA Change: I229K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 381 3e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081554
AA Change: I202K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080269
Gene: ENSMUSG00000029470
AA Change: I202K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 1.6e-72 PFAM
Pfam:P2X_receptor 170 361 2.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132062
Predicted Effect probably damaging
Transcript: ENSMUST00000139631
AA Change: I202K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118163
Gene: ENSMUSG00000029470
AA Change: I202K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 176 3.7e-73 PFAM
Pfam:P2X_receptor 171 301 4.6e-59 PFAM
Pfam:P2X_receptor 299 331 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139712
Predicted Effect probably damaging
Transcript: ENSMUST00000142664
AA Change: I229K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117193
Gene: ENSMUSG00000029470
AA Change: I229K

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 358 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198560
SMART Domains Protein: ENSMUSP00000142849
Gene: ENSMUSG00000029470

DomainStartEndE-ValueType
Pfam:P2X_receptor 13 47 6.9e-9 PFAM
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in hypertension, abnormal artery morphology, abnormal nitric oxide homeostasis, and impaired flow induced vascular remodeling and vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in P2rx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0709:P2rx4 UTSW 5 122714404 missense probably damaging 1.00
R1081:P2rx4 UTSW 5 122727233 missense probably damaging 0.98
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R1464:P2rx4 UTSW 5 122714539 missense probably damaging 0.97
R3435:P2rx4 UTSW 5 122725070 missense probably damaging 1.00
R5090:P2rx4 UTSW 5 122725055 missense probably damaging 1.00
R5318:P2rx4 UTSW 5 122719148 missense probably null 1.00
R5888:P2rx4 UTSW 5 122719165 missense probably benign
R5888:P2rx4 UTSW 5 122727208 missense probably damaging 1.00
R5994:P2rx4 UTSW 5 122725079 missense probably damaging 1.00
R6450:P2rx4 UTSW 5 122727241 missense possibly damaging 0.88
R6478:P2rx4 UTSW 5 122707700 missense probably damaging 0.99
R6847:P2rx4 UTSW 5 122727751 missense probably damaging 1.00
X0064:P2rx4 UTSW 5 122707779 nonsense probably null
X0066:P2rx4 UTSW 5 122707745 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCTGCAGAAAACTTCACCC -3'
(R):5'- TGGATACCCATGATGCCTCC -3'

Sequencing Primer
(F):5'- TCCATAACGAGATCTGGTGC -3'
(R):5'- GATACCCATGATGCCTCCCTGTG -3'
Posted On2015-02-18