Mutagenetix > Incidental Mutations

Incidental Mutation 'R3434:Tubgcp3'

266348

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp3

Ensembl Gene

ENSMUSG00000000759

Gene Name

tubulin, gamma complex associated protein 3

Synonyms

Spc98p, GCP3

MMRRC Submission

040652-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12614277-12672248 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 12658381 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000000776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]

Predicted Effect

probably null
Transcript: ENSMUST00000000776

SMART Domains

Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759

Domain	Start	End	E-Value	Type
low complexity region	152	171	N/A	INTRINSIC
Pfam:Spc97_Spc98	251	761	9.5e-124	PFAM
coiled coil region	787	814	N/A	INTRINSIC
low complexity region	821	827	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164774

SMART Domains

Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759

Domain	Start	End	E-Value	Type
low complexity region	152	171	N/A	INTRINSIC
Pfam:Spc97_Spc98	251	361	3.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164861

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164971

Predicted Effect

probably benign
Transcript: ENSMUST00000165321

SMART Domains

Protein: ENSMUSP00000131051
Gene: ENSMUSG00000000759

Domain	Start	End	E-Value	Type
low complexity region	35	54	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167547

Predicted Effect

probably benign
Transcript: ENSMUST00000172056

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Tubgcp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Tubgcp3	APN	8	12621809	missense	probably benign	0.00
IGL00583:Tubgcp3	APN	8	12621906	nonsense	probably null
IGL01289:Tubgcp3	APN	8	12639625	missense	probably damaging	1.00
IGL01578:Tubgcp3	APN	8	12661297	splice site	probably benign
IGL01716:Tubgcp3	APN	8	12641094	splice site	probably benign
IGL01943:Tubgcp3	APN	8	12654301	missense	probably damaging	1.00
IGL02020:Tubgcp3	APN	8	12637780	missense	possibly damaging	0.46
IGL02345:Tubgcp3	APN	8	12625056	missense	probably damaging	1.00
IGL02555:Tubgcp3	APN	8	12639595	missense	probably benign	0.36
IGL02644:Tubgcp3	APN	8	12648733	missense	probably damaging	1.00
IGL02976:Tubgcp3	APN	8	12632300	missense	probably damaging	1.00
IGL03240:Tubgcp3	APN	8	12649797	missense	probably benign	0.07
IGL03287:Tubgcp3	APN	8	12639630	missense	possibly damaging	0.77
Tinky_winky	UTSW	8	12650171	missense	probably damaging	1.00
R0145:Tubgcp3	UTSW	8	12657561	missense	probably benign	0.01
R0379:Tubgcp3	UTSW	8	12641116	missense	probably damaging	0.97
R0558:Tubgcp3	UTSW	8	12653462	missense	probably benign	0.00
R1490:Tubgcp3	UTSW	8	12639550	missense	probably damaging	1.00
R1709:Tubgcp3	UTSW	8	12639532	nonsense	probably null
R1768:Tubgcp3	UTSW	8	12649686	unclassified	probably benign
R1921:Tubgcp3	UTSW	8	12621932	nonsense	probably null
R1928:Tubgcp3	UTSW	8	12663988	missense	possibly damaging	0.94
R2161:Tubgcp3	UTSW	8	12632292	missense	probably benign	0.22
R3120:Tubgcp3	UTSW	8	12657626	missense	possibly damaging	0.51
R4011:Tubgcp3	UTSW	8	12639634	nonsense	probably null
R4162:Tubgcp3	UTSW	8	12639547	missense	possibly damaging	0.46
R4300:Tubgcp3	UTSW	8	12657600	missense	probably damaging	0.99
R4350:Tubgcp3	UTSW	8	12641117	missense	probably benign	0.19
R4529:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4530:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4531:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4676:Tubgcp3	UTSW	8	12650171	missense	probably damaging	1.00
R4730:Tubgcp3	UTSW	8	12657654	missense	probably benign	0.03
R4828:Tubgcp3	UTSW	8	12671987	missense	probably benign
R4860:Tubgcp3	UTSW	8	12649722	missense	probably benign	0.03
R4860:Tubgcp3	UTSW	8	12649722	missense	probably benign	0.03
R5610:Tubgcp3	UTSW	8	12639577	missense	probably damaging	1.00
R5625:Tubgcp3	UTSW	8	12624888	missense	possibly damaging	0.46
R5650:Tubgcp3	UTSW	8	12648670	missense	probably damaging	0.98
R5775:Tubgcp3	UTSW	8	12625056	missense	probably damaging	1.00
R6257:Tubgcp3	UTSW	8	12649835	splice site	probably null
R6314:Tubgcp3	UTSW	8	12648625	missense	probably benign	0.02
R6970:Tubgcp3	UTSW	8	12637000	missense	probably damaging	0.98
R7173:Tubgcp3	UTSW	8	12639259	intron	probably null
R7408:Tubgcp3	UTSW	8	12661359	nonsense	probably null
R7502:Tubgcp3	UTSW	8	12641207	missense	probably damaging	0.99
R7701:Tubgcp3	UTSW	8	12655974	missense	probably benign
R7739:Tubgcp3	UTSW	8	12657561	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACATCTTCTGGAAGCTGCC -3'
(R):5'- CCCAGAGAAGACTGATCGTGTC -3'

Sequencing Primer
(F):5'- ATACGTGGCTTCCGAAGATG -3'
(R):5'- GAAGACTGATCGTGTCCAGTC -3'

Posted On

2015-02-18