Incidental Mutation 'R3434:Carm1'
ID266350
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Namecoactivator-associated arginine methyltransferase 1
SynonymsPrmt4
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21546894-21592623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21569473 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 81 (F81S)
Ref Sequence ENSEMBL: ENSMUSP00000117243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034703] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032]
Predicted Effect probably benign
Transcript: ENSMUST00000034703
AA Change: F81S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185
AA Change: F81S

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115394
AA Change: F81S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185
AA Change: F81S

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115395
AA Change: F81S

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185
AA Change: F81S

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130032
AA Change: F81S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185
AA Change: F81S

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Meta Mutation Damage Score 0.3975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21587194 missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21587302 missense probably benign 0.19
IGL01401:Carm1 APN 9 21569582 critical splice donor site probably null
IGL02218:Carm1 APN 9 21569512 missense probably damaging 1.00
IGL02436:Carm1 APN 9 21579462 missense probably damaging 1.00
IGL02601:Carm1 APN 9 21586908 missense probably damaging 1.00
R0551:Carm1 UTSW 9 21580491 splice site probably null
R0580:Carm1 UTSW 9 21583584 missense probably damaging 1.00
R0724:Carm1 UTSW 9 21587374 missense probably damaging 1.00
R0883:Carm1 UTSW 9 21569591 splice site probably benign
R1390:Carm1 UTSW 9 21579493 missense probably damaging 1.00
R1713:Carm1 UTSW 9 21586489 missense probably damaging 0.97
R1950:Carm1 UTSW 9 21574516 missense probably benign 0.01
R1960:Carm1 UTSW 9 21580310 missense probably benign 0.40
R2402:Carm1 UTSW 9 21583540 missense probably damaging 1.00
R2512:Carm1 UTSW 9 21575412 critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21583597 splice site probably null
R2939:Carm1 UTSW 9 21579396 splice site probably null
R2940:Carm1 UTSW 9 21579396 splice site probably null
R3081:Carm1 UTSW 9 21579396 splice site probably null
R3407:Carm1 UTSW 9 21586182 missense probably damaging 1.00
R3808:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R4504:Carm1 UTSW 9 21569526 missense probably damaging 1.00
R4700:Carm1 UTSW 9 21587184 missense probably benign 0.12
R5019:Carm1 UTSW 9 21579511 critical splice donor site probably null
R5362:Carm1 UTSW 9 21587359 missense probably benign 0.03
R5661:Carm1 UTSW 9 21586999 missense probably benign 0.10
R5730:Carm1 UTSW 9 21580340 missense probably benign 0.37
R5913:Carm1 UTSW 9 21587552 missense probably benign 0.01
R5928:Carm1 UTSW 9 21575302 intron probably benign
R6370:Carm1 UTSW 9 21587519 missense probably benign 0.11
R6431:Carm1 UTSW 9 21583077 missense probably damaging 1.00
R6555:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R7177:Carm1 UTSW 9 21547027 missense unknown
R7235:Carm1 UTSW 9 21587405 critical splice donor site probably benign
R7249:Carm1 UTSW 9 21586209 missense probably benign
R7576:Carm1 UTSW 9 21586536 critical splice donor site probably null
R7650:Carm1 UTSW 9 21580372 missense probably benign 0.00
R7664:Carm1 UTSW 9 21586990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACTAGAGAGACATAGGCTGACAT -3'
(R):5'- GCATTGGGAATATGCAAGTGC -3'

Sequencing Primer
(F):5'- TAGCACTTCAAAGTTGTTATGAGGC -3'
(R):5'- TGATGAAGGACTGTCTGC -3'
Posted On2015-02-18