Incidental Mutation 'R3434:Chrna3'
ID 266351
Institutional Source Beutler Lab
Gene Symbol Chrna3
Ensembl Gene ENSMUSG00000032303
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 3
Synonyms A730007P14Rik, Acra3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, alpha 3, (a)3, Acra-3
MMRRC Submission 040652-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R3434 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 55010111-55026562 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55024326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 61 (I61F)
Ref Sequence ENSEMBL: ENSMUSP00000034851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034851] [ENSMUST00000034854] [ENSMUST00000214204]
AlphaFold Q8R4G9
Predicted Effect possibly damaging
Transcript: ENSMUST00000034851
AA Change: I61F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034851
Gene: ENSMUSG00000032303
AA Change: I61F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 34 240 6.1e-77 PFAM
Pfam:Neur_chan_memb 247 494 7.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034854
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214204
AA Change: I61F

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.6285 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation show high postnatal and postweaning mortality. Mutants show reduced bladder contractility resulting in enlarged bladder, infections and urinary stones. Eyes are small, with dilated ocular pupils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Chrna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Chrna3 APN 9 55016006 missense probably benign 0.01
IGL02484:Chrna3 APN 9 55015537 missense probably damaging 1.00
R0494:Chrna3 UTSW 9 55022278 missense probably damaging 1.00
R0538:Chrna3 UTSW 9 55016006 missense probably benign 0.01
R0557:Chrna3 UTSW 9 55015865 missense probably damaging 1.00
R0674:Chrna3 UTSW 9 55015172 missense probably damaging 1.00
R1552:Chrna3 UTSW 9 55015908 missense probably benign 0.16
R1750:Chrna3 UTSW 9 55016057 missense probably damaging 1.00
R2191:Chrna3 UTSW 9 55016045 missense probably damaging 1.00
R2989:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3114:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3153:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3154:Chrna3 UTSW 9 55016050 missense probably damaging 1.00
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3732:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R3733:Chrna3 UTSW 9 55015894 missense probably benign 0.00
R4758:Chrna3 UTSW 9 55022276 missense probably damaging 1.00
R4903:Chrna3 UTSW 9 55015526 missense probably benign 0.01
R5430:Chrna3 UTSW 9 55012908 missense probably damaging 0.98
R5795:Chrna3 UTSW 9 55015268 missense probably benign 0.17
R6546:Chrna3 UTSW 9 55015901 missense probably damaging 1.00
R6806:Chrna3 UTSW 9 55015810 missense probably damaging 1.00
R7516:Chrna3 UTSW 9 55015369 missense probably benign 0.00
R7703:Chrna3 UTSW 9 55016124 missense probably benign 0.00
R8053:Chrna3 UTSW 9 55015390 missense probably benign 0.25
R8762:Chrna3 UTSW 9 55015711 missense probably damaging 1.00
R9170:Chrna3 UTSW 9 55026387 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCTTCAGCCACAGGTTG -3'
(R):5'- ATTACTAGCCTGGAAGCCCG -3'

Sequencing Primer
(F):5'- CACAGGTTGGTTTCCATGATC -3'
(R):5'- TTTGCAGAGTACCCTGGCAGAC -3'
Posted On 2015-02-18