Mutagenetix > Incidental Mutation

Incidental Mutation 'R3434:Sacs'

266363

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

MMRRC Submission

040652-MU

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61212303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 3933 (K3933E)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119943
AA Change: K3933E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: K3933E

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Meta Mutation Damage Score

0.1588

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
BB009:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
BB019:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0748:Sacs	UTSW	14	61209265	missense	probably damaging	0.99
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1499:Sacs	UTSW	14	61213704	missense	possibly damaging	0.70
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R1976:Sacs	UTSW	14	61202895	missense	probably benign
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	splice site	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2436:Sacs	UTSW	14	61202905	missense	possibly damaging	0.94
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	splice site	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R4986:Sacs	UTSW	14	61213043	nonsense	probably null
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6731:Sacs	UTSW	14	61180700	splice site	probably null
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
R7023:Sacs	UTSW	14	61208815	missense	probably benign	0.04
R7047:Sacs	UTSW	14	61213002	missense	probably damaging	1.00
R7051:Sacs	UTSW	14	61208928	missense	probably benign	0.25
R7069:Sacs	UTSW	14	61212496	missense	probably damaging	1.00
R7082:Sacs	UTSW	14	61210517	missense	possibly damaging	0.94
R7108:Sacs	UTSW	14	61211009	nonsense	probably null
R7122:Sacs	UTSW	14	61210396	missense	probably damaging	1.00
R7194:Sacs	UTSW	14	61210089	missense	possibly damaging	0.95
R7214:Sacs	UTSW	14	61191792	missense	probably benign
R7221:Sacs	UTSW	14	61208806	missense	probably damaging	0.99
R7274:Sacs	UTSW	14	61214081	missense	possibly damaging	0.88
R7344:Sacs	UTSW	14	61207444	missense	possibly damaging	0.81
R7440:Sacs	UTSW	14	61191605	missense	probably benign	0.10
R7474:Sacs	UTSW	14	61211178	missense	probably benign	0.04
R7512:Sacs	UTSW	14	61204430	missense	probably benign	0.04
R7641:Sacs	UTSW	14	61202871	missense	probably damaging	0.97
R7649:Sacs	UTSW	14	61203228	missense	possibly damaging	0.53
R7703:Sacs	UTSW	14	61206090	missense	possibly damaging	0.81
R7792:Sacs	UTSW	14	61209773	missense	probably benign	0.00
R7805:Sacs	UTSW	14	61203591	missense	not run
R7822:Sacs	UTSW	14	61192203	missense	probably benign	0.03
R7882:Sacs	UTSW	14	61207071	missense	probably benign	0.02
R7932:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
R8031:Sacs	UTSW	14	61204191	missense	probably damaging	0.96
R8064:Sacs	UTSW	14	61192175	missense	possibly damaging	0.92
R8083:Sacs	UTSW	14	61210717	missense	possibly damaging	0.77
R8204:Sacs	UTSW	14	61212948	missense	probably damaging	0.96
R8293:Sacs	UTSW	14	61191099	missense	probably damaging	0.99
R8316:Sacs	UTSW	14	61189619	missense	possibly damaging	0.84
R8393:Sacs	UTSW	14	61173206	start codon destroyed	probably null	0.06
R8434:Sacs	UTSW	14	61213187	nonsense	probably null
R8482:Sacs	UTSW	14	61202955	missense	probably benign
R8497:Sacs	UTSW	14	61192253	missense	probably benign	0.00
R8557:Sacs	UTSW	14	61207276	missense	probably damaging	1.00
R8698:Sacs	UTSW	14	61213353	missense	probably benign
R8840:Sacs	UTSW	14	61191728	missense	probably benign	0.25
R8924:Sacs	UTSW	14	61192446	missense	probably benign	0.22
R8924:Sacs	UTSW	14	61211253	missense	probably damaging	1.00
R8941:Sacs	UTSW	14	61192573	missense	probably benign	0.00
R9007:Sacs	UTSW	14	61207736	missense	probably benign	0.04
R9008:Sacs	UTSW	14	61204543	missense	probably benign	0.19
R9070:Sacs	UTSW	14	61210302	missense	probably benign
R9147:Sacs	UTSW	14	61212688	missense	possibly damaging	0.86
R9185:Sacs	UTSW	14	61206666	missense	probably damaging	0.98
R9290:Sacs	UTSW	14	61184050	missense	probably benign	0.17
R9294:Sacs	UTSW	14	61240319	missense	possibly damaging	0.84
R9339:Sacs	UTSW	14	61205860	missense	probably benign	0.00
R9341:Sacs	UTSW	14	61208770	missense	probably benign	0.08
R9343:Sacs	UTSW	14	61208770	missense	probably benign	0.08
R9370:Sacs	UTSW	14	61203631	missense	probably damaging	1.00
R9433:Sacs	UTSW	14	61206548	missense	probably damaging	1.00
R9460:Sacs	UTSW	14	61204162	missense	probably benign	0.34
R9548:Sacs	UTSW	14	61203243	missense	probably benign	0.02
R9564:Sacs	UTSW	14	61211597	missense	probably damaging	1.00
R9644:Sacs	UTSW	14	61205979	missense	probably benign	0.00
R9683:Sacs	UTSW	14	61213432	missense	possibly damaging	0.95
R9706:Sacs	UTSW	14	61208373	nonsense	probably null
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00
Z1176:Sacs	UTSW	14	61210830	nonsense	probably null
Z1176:Sacs	UTSW	14	61213200	missense	probably damaging	1.00
Z1177:Sacs	UTSW	14	61191551	missense	possibly damaging	0.48
Z1177:Sacs	UTSW	14	61207981	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGCAGCTAGACCCTAATGAAATG -3'
(R):5'- CCCTGAAGAGAGCACAATGC -3'

Sequencing Primer
(F):5'- GCTAGACCCTAATGAAATGCGTACAG -3'
(R):5'- AAACTGGCACACTTTAGGGGTCTC -3'

Posted On

2015-02-18