Mutagenetix > Incidental Mutation

Incidental Mutation 'R3434:Azin1'

266364

Institutional Source

Beutler Lab

Gene Symbol

Azin1

Ensembl Gene

ENSMUSG00000037458

Gene Name

antizyme inhibitor 1

Synonyms

ODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik

MMRRC Submission

040652-MU

Accession Numbers

Genbank: NM_018745; MGI: 1859169

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38487427-38519266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38493576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 268 (I268V)

Ref Sequence

ENSEMBL: ENSMUSP00000105958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000129589]

AlphaFold

O35484

Predicted Effect

probably benign
Transcript: ENSMUST00000065308
AA Change: I268V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: I268V

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	5.2e-66	PFAM
Pfam:Orn_DAP_Arg_deC	282	406	1.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110328

SMART Domains

Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	9.4e-67	PFAM
Pfam:Orn_DAP_Arg_deC	282	357	7.4e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110329
AA Change: I268V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: I268V

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	5.4e-69	PFAM
Pfam:Orn_DAP_Arg_deC	283	405	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129589

SMART Domains

Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	154	1.8e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149293

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226152

Meta Mutation Damage Score

0.2289

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Azin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02174:Azin1	APN	15	38493486	missense	probably benign
IGL02406:Azin1	APN	15	38491565	missense	probably benign	0.00
H2330:Azin1	UTSW	15	38497276	missense	probably damaging	0.98
R0562:Azin1	UTSW	15	38493581	missense	probably benign	0.00
R3416:Azin1	UTSW	15	38493546	missense	possibly damaging	0.89
R3978:Azin1	UTSW	15	38498713	missense	probably damaging	0.99
R4535:Azin1	UTSW	15	38493605	missense	probably benign	0.11
R4720:Azin1	UTSW	15	38493500	missense	probably benign	0.43
R5266:Azin1	UTSW	15	38491551	missense	probably benign
R6416:Azin1	UTSW	15	38492343	missense	possibly damaging	0.71
R7242:Azin1	UTSW	15	38501505	start codon destroyed	probably null	1.00
R7283:Azin1	UTSW	15	38501408	missense	probably damaging	0.98
R7577:Azin1	UTSW	15	38501421	missense	probably benign	0.01
R7604:Azin1	UTSW	15	38491634	missense	probably damaging	1.00
R8221:Azin1	UTSW	15	38492328	missense	probably damaging	1.00
R8683:Azin1	UTSW	15	38493531	missense	probably damaging	1.00
R9229:Azin1	UTSW	15	38490402	missense	probably benign
R9420:Azin1	UTSW	15	38493627	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CTGACGCTCTAGTAAAGTAAGAGGTAG -3'
(R):5'- TCCCTGCTAGGTTGGAATTG -3'

Sequencing Primer
(F):5'- GTAGATTCTCCATCCAATACAAGAGG -3'
(R):5'- CCCTGCTAGGTTGGAATTGAATAG -3'

Posted On

2015-02-18