Incidental Mutation 'R3434:Tmem117'
ID 266365
Institutional Source Beutler Lab
Gene Symbol Tmem117
Ensembl Gene ENSMUSG00000063296
Gene Name transmembrane protein 117
Synonyms B930062P21Rik
MMRRC Submission 040652-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R3434 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 94527113-94993979 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94992573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 411 (I411T)
Ref Sequence ENSEMBL: ENSMUSP00000079038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080141] [ENSMUST00000229933]
AlphaFold Q8BH18
Predicted Effect probably damaging
Transcript: ENSMUST00000080141
AA Change: I411T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079038
Gene: ENSMUSG00000063296
AA Change: I411T

DomainStartEndE-ValueType
Pfam:TMEM117 4 416 1.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189291
Predicted Effect probably benign
Transcript: ENSMUST00000229933
Meta Mutation Damage Score 0.1689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,508,511 (GRCm39) A1008V probably damaging Het
Adora3 A G 3: 105,812,231 (GRCm39) K39R probably benign Het
Ankib1 A G 5: 3,742,760 (GRCm39) V1085A probably damaging Het
Atp7a G A X: 105,138,463 (GRCm39) R563K probably benign Het
Azin1 T C 15: 38,493,820 (GRCm39) I268V probably benign Het
Carm1 T C 9: 21,480,769 (GRCm39) F81S probably damaging Het
Ccnjl A G 11: 43,470,688 (GRCm39) Y152C probably damaging Het
Chrna3 T A 9: 54,931,610 (GRCm39) I61F possibly damaging Het
Clca3a2 G A 3: 144,514,522 (GRCm39) probably benign Het
Clstn2 T A 9: 97,336,768 (GRCm39) D903V probably benign Het
Dpysl3 C T 18: 43,494,126 (GRCm39) V70I probably benign Het
Drg2 A T 11: 60,352,218 (GRCm39) K180* probably null Het
Dync2h1 A C 9: 7,011,236 (GRCm39) H3659Q probably benign Het
Dysf A T 6: 84,047,870 (GRCm39) Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 (GRCm39) N533D probably benign Het
Fam47e T A 5: 92,733,221 (GRCm39) V152D probably damaging Het
Fasn G A 11: 120,713,599 (GRCm39) A24V probably damaging Het
Fhl4 T C 10: 84,934,308 (GRCm39) T158A probably benign Het
Fnbp1l C T 3: 122,339,955 (GRCm39) R499Q probably damaging Het
Hdlbp A T 1: 93,355,883 (GRCm39) M358K probably benign Het
Ift74 A G 4: 94,510,089 (GRCm39) probably null Het
Lhx4 A G 1: 155,578,147 (GRCm39) Y332H probably damaging Het
Mast2 A T 4: 116,165,292 (GRCm39) S1314T probably benign Het
Mast4 A G 13: 102,923,887 (GRCm39) I508T probably damaging Het
Mdn1 T C 4: 32,733,726 (GRCm39) probably null Het
Mrps23 A G 11: 88,100,940 (GRCm39) K44E probably damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mup6 G T 4: 60,004,116 (GRCm39) probably null Het
Notch3 A T 17: 32,377,592 (GRCm39) D161E possibly damaging Het
Or2ag13 A T 7: 106,472,976 (GRCm39) Y159N probably benign Het
Or4a67 T C 2: 88,598,413 (GRCm39) D82G probably damaging Het
Or5w11 T C 2: 87,459,418 (GRCm39) F204L probably benign Het
P2rx4 T A 5: 122,863,133 (GRCm39) I202K probably damaging Het
Phykpl A G 11: 51,489,482 (GRCm39) T363A probably benign Het
Pitpnm1 G A 19: 4,162,234 (GRCm39) A1047T probably damaging Het
Ppat A G 5: 77,065,912 (GRCm39) I402T probably damaging Het
Rpgr A G X: 10,042,841 (GRCm39) S656P probably benign Het
Rsbn1l T C 5: 21,110,928 (GRCm39) probably benign Het
Sacs A G 14: 61,449,752 (GRCm39) K3933E probably damaging Het
Scn7a T C 2: 66,505,847 (GRCm39) I1681V probably benign Het
Sel1l3 T C 5: 53,274,432 (GRCm39) D1016G probably benign Het
Sf3a3 C A 4: 124,618,870 (GRCm39) T277N possibly damaging Het
Slc35a5 A G 16: 44,964,396 (GRCm39) I279T probably benign Het
Slc39a10 T C 1: 46,874,877 (GRCm39) T142A probably benign Het
Tle3 T A 9: 61,321,376 (GRCm39) probably null Het
Ttn T C 2: 76,698,721 (GRCm39) T5A possibly damaging Het
Tubgcp3 T C 8: 12,708,381 (GRCm39) probably null Het
Ush2a C T 1: 188,465,955 (GRCm39) P2841L probably damaging Het
Vmn1r209 A T 13: 22,990,267 (GRCm39) M141K probably benign Het
Vmn2r91 A T 17: 18,330,370 (GRCm39) probably benign Het
Other mutations in Tmem117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Tmem117 APN 15 94,992,545 (GRCm39) missense probably benign
IGL02342:Tmem117 APN 15 94,909,331 (GRCm39) missense possibly damaging 0.76
IGL02418:Tmem117 APN 15 94,829,765 (GRCm39) missense probably benign 0.10
IGL02651:Tmem117 APN 15 94,992,442 (GRCm39) missense probably damaging 1.00
IGL02740:Tmem117 APN 15 94,612,863 (GRCm39) missense probably benign 0.00
IGL02819:Tmem117 APN 15 94,777,253 (GRCm39) splice site probably benign
IGL02881:Tmem117 APN 15 94,777,306 (GRCm39) missense probably damaging 1.00
IGL02887:Tmem117 APN 15 94,992,656 (GRCm39) missense probably damaging 1.00
IGL03371:Tmem117 APN 15 94,909,274 (GRCm39) missense probably damaging 1.00
R0464:Tmem117 UTSW 15 94,612,800 (GRCm39) missense probably damaging 0.98
R0539:Tmem117 UTSW 15 94,612,793 (GRCm39) missense possibly damaging 0.63
R1029:Tmem117 UTSW 15 94,909,217 (GRCm39) missense probably benign
R1424:Tmem117 UTSW 15 94,829,689 (GRCm39) missense probably benign 0.35
R1439:Tmem117 UTSW 15 94,992,478 (GRCm39) missense probably benign
R1498:Tmem117 UTSW 15 94,536,242 (GRCm39) missense probably damaging 1.00
R1604:Tmem117 UTSW 15 94,992,425 (GRCm39) missense probably damaging 1.00
R1746:Tmem117 UTSW 15 94,829,714 (GRCm39) missense possibly damaging 0.55
R1829:Tmem117 UTSW 15 94,992,432 (GRCm39) missense probably damaging 1.00
R3435:Tmem117 UTSW 15 94,992,573 (GRCm39) missense probably damaging 0.98
R4560:Tmem117 UTSW 15 94,992,677 (GRCm39) missense probably benign 0.00
R4561:Tmem117 UTSW 15 94,992,677 (GRCm39) missense probably benign 0.00
R4562:Tmem117 UTSW 15 94,992,677 (GRCm39) missense probably benign 0.00
R4563:Tmem117 UTSW 15 94,536,035 (GRCm39) missense possibly damaging 0.95
R4777:Tmem117 UTSW 15 94,992,331 (GRCm39) nonsense probably null
R4854:Tmem117 UTSW 15 94,992,569 (GRCm39) missense probably damaging 0.97
R5051:Tmem117 UTSW 15 94,612,794 (GRCm39) missense probably damaging 0.96
R5472:Tmem117 UTSW 15 94,992,394 (GRCm39) missense possibly damaging 0.91
R5485:Tmem117 UTSW 15 94,992,711 (GRCm39) missense probably benign 0.00
R5488:Tmem117 UTSW 15 94,992,698 (GRCm39) frame shift probably null
R5595:Tmem117 UTSW 15 94,992,765 (GRCm39) missense probably damaging 0.99
R5648:Tmem117 UTSW 15 94,992,653 (GRCm39) missense possibly damaging 0.88
R5892:Tmem117 UTSW 15 94,536,020 (GRCm39) missense probably damaging 0.99
R5901:Tmem117 UTSW 15 94,612,839 (GRCm39) missense probably benign 0.08
R6334:Tmem117 UTSW 15 94,909,324 (GRCm39) missense probably benign 0.01
R7216:Tmem117 UTSW 15 94,612,793 (GRCm39) missense possibly damaging 0.91
R7266:Tmem117 UTSW 15 94,829,684 (GRCm39) missense possibly damaging 0.82
R7414:Tmem117 UTSW 15 94,612,776 (GRCm39) missense probably damaging 1.00
R7445:Tmem117 UTSW 15 94,612,799 (GRCm39) missense probably benign 0.05
R8205:Tmem117 UTSW 15 94,992,679 (GRCm39) missense probably benign
R8698:Tmem117 UTSW 15 94,535,990 (GRCm39) missense probably benign 0.17
R8719:Tmem117 UTSW 15 94,992,248 (GRCm39) missense probably damaging 1.00
R9581:Tmem117 UTSW 15 94,992,268 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GACAGTATATTGGCCCAGGG -3'
(R):5'- ACCAAGGCAGGGTCATTCAG -3'

Sequencing Primer
(F):5'- CCCAGGGCAGAAGATATACACAGTG -3'
(R):5'- GGTCATTCAGAGGATCTTCCACAG -3'
Posted On 2015-02-18