Mutagenetix > Incidental Mutation

Incidental Mutation 'R3434:Notch3'

266370

Institutional Source

Beutler Lab

Gene Symbol

Notch3

Ensembl Gene

ENSMUSG00000038146

Gene Name

notch 3

Synonyms

N3, hpbk

MMRRC Submission

040652-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32120820-32166880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32158618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 161 (D161E)

Ref Sequence

ENSEMBL: ENSMUSP00000085016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087723]

AlphaFold

Q61982

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087723
AA Change: D161E

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: D161E

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
EGF	42	78	3.73e-5	SMART
EGF	82	119	1.78e-2	SMART
EGF	123	157	1.13e-4	SMART
EGF_CA	159	196	1.89e-15	SMART
EGF	201	235	3.85e-7	SMART
EGF_CA	237	273	3.97e-9	SMART
EGF_CA	275	313	4.63e-10	SMART
EGF_CA	315	351	1.05e-8	SMART
EGF	355	390	1.28e-3	SMART
EGF_CA	392	430	6.29e-12	SMART
EGF_CA	432	468	1.11e-12	SMART
EGF_CA	470	506	4.21e-13	SMART
EGF_CA	508	544	8.43e-13	SMART
EGF_CA	546	581	9.54e-12	SMART
EGF_CA	583	619	1.31e-9	SMART
EGF_CA	621	656	2.03e-6	SMART
EGF_CA	658	694	2.28e-9	SMART
EGF	699	731	7.18e-7	SMART
EGF	738	771	2.5e-6	SMART
EGF	775	809	8e-5	SMART
EGF_CA	811	848	4.77e-12	SMART
EGF_CA	850	886	3.81e-11	SMART
EGF_CA	888	923	1.47e-12	SMART
EGF_CA	925	961	3.4e-8	SMART
EGF	966	999	5.74e-6	SMART
EGF	1004	1035	7.18e-7	SMART
EGF	1040	1083	1.21e-4	SMART
EGF_CA	1085	1121	1.29e-8	SMART
EGF_CA	1123	1159	1.45e-11	SMART
EGF_CA	1161	1204	1.26e-11	SMART
EGF	1209	1245	1.53e-1	SMART
EGF	1250	1288	8e-5	SMART
EGF	1293	1326	1.13e1	SMART
EGF	1339	1374	5.36e-6	SMART
NL	1381	1419	1.63e-15	SMART
NL	1422	1460	1.78e-16	SMART
NL	1461	1502	1.75e-15	SMART
NOD	1506	1562	2.98e-24	SMART
NODP	1577	1641	1.34e-26	SMART
transmembrane domain	1644	1666	N/A	INTRINSIC
low complexity region	1774	1783	N/A	INTRINSIC
ANK	1789	1834	1.48e3	SMART
ANK	1839	1868	1.61e-4	SMART
ANK	1872	1902	1.42e0	SMART
ANK	1906	1935	1.77e-1	SMART
ANK	1939	1968	3.18e-3	SMART
ANK	1972	2001	5.16e-3	SMART
low complexity region	2028	2054	N/A	INTRINSIC
low complexity region	2108	2123	N/A	INTRINSIC
low complexity region	2169	2193	N/A	INTRINSIC
DUF3454	2218	2275	2.81e-20	SMART

Meta Mutation Damage Score

0.4001

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Notch3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Notch3	APN	17	32158114	nonsense	probably null
IGL01065:Notch3	APN	17	32146416	nonsense	probably null
IGL01296:Notch3	APN	17	32166757	missense	unknown
IGL01322:Notch3	APN	17	32144471	missense	probably damaging	1.00
IGL01343:Notch3	APN	17	32143436	missense	probably benign	0.10
IGL01358:Notch3	APN	17	32144747	missense	probably damaging	1.00
IGL01600:Notch3	APN	17	32144498	missense	probably damaging	1.00
IGL01622:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01623:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01971:Notch3	APN	17	32124347	missense	probably damaging	1.00
IGL02000:Notch3	APN	17	32122742	missense	probably damaging	0.99
IGL02072:Notch3	APN	17	32147074	nonsense	probably null
IGL02145:Notch3	APN	17	32154741	missense	probably benign	0.01
IGL02256:Notch3	APN	17	32132324	missense	probably damaging	1.00
IGL02366:Notch3	APN	17	32144205	missense	probably benign
IGL02476:Notch3	APN	17	32158638	missense	possibly damaging	0.67
IGL02502:Notch3	APN	17	32158278	nonsense	probably null
IGL02551:Notch3	APN	17	32154731	splice site	probably benign
divide	UTSW	17	32137813	splice site	probably null
impressed	UTSW	17	32166678	missense	probably benign
indented	UTSW	17	32147963	missense	probably benign	0.00
Lopressor	UTSW	17	32153884	missense	probably damaging	1.00
marginal	UTSW	17	32164224	missense	probably benign
PIT4486001:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R0115:Notch3	UTSW	17	32133462	missense	possibly damaging	0.82
R0201:Notch3	UTSW	17	32156148	splice site	probably benign
R0630:Notch3	UTSW	17	32147472	splice site	probably benign
R1167:Notch3	UTSW	17	32122745	missense	possibly damaging	0.95
R1432:Notch3	UTSW	17	32164224	missense	probably benign
R1567:Notch3	UTSW	17	32158580	missense	possibly damaging	0.77
R1623:Notch3	UTSW	17	32139191	missense	probably benign	0.00
R1663:Notch3	UTSW	17	32156119	missense	probably damaging	1.00
R1668:Notch3	UTSW	17	32158589	missense	probably damaging	0.99
R1789:Notch3	UTSW	17	32158725	missense	probably damaging	1.00
R1813:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1837:Notch3	UTSW	17	32124322	missense	probably damaging	1.00
R1896:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1937:Notch3	UTSW	17	32153852	missense	probably benign	0.03
R1954:Notch3	UTSW	17	32166678	missense	probably benign
R2014:Notch3	UTSW	17	32158000	missense	probably benign	0.00
R2058:Notch3	UTSW	17	32143644	missense	probably benign
R2068:Notch3	UTSW	17	32135508	missense	probably benign	0.00
R2097:Notch3	UTSW	17	32122754	missense	probably damaging	1.00
R2112:Notch3	UTSW	17	32144610	missense	probably benign	0.19
R2156:Notch3	UTSW	17	32147844	missense	probably damaging	1.00
R2211:Notch3	UTSW	17	32147978	missense	probably benign	0.00
R2324:Notch3	UTSW	17	32150134	splice site	probably benign
R2432:Notch3	UTSW	17	32153804	missense	probably damaging	1.00
R3117:Notch3	UTSW	17	32158115	missense	probably damaging	1.00
R3236:Notch3	UTSW	17	32158461	missense	probably damaging	0.96
R3409:Notch3	UTSW	17	32150702	missense	possibly damaging	0.67
R3435:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3438:Notch3	UTSW	17	32153590	missense	probably damaging	1.00
R3926:Notch3	UTSW	17	32153557	missense	possibly damaging	0.92
R4087:Notch3	UTSW	17	32158113	missense	possibly damaging	0.60
R4115:Notch3	UTSW	17	32158433	missense	probably damaging	1.00
R4214:Notch3	UTSW	17	32132207	missense	possibly damaging	0.96
R4234:Notch3	UTSW	17	32141341	missense	probably damaging	0.97
R4242:Notch3	UTSW	17	32143745	missense	possibly damaging	0.74
R4658:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R4878:Notch3	UTSW	17	32147085	missense	probably damaging	1.00
R4879:Notch3	UTSW	17	32147963	missense	probably benign	0.00
R4885:Notch3	UTSW	17	32141377	missense	probably damaging	0.98
R4924:Notch3	UTSW	17	32144731	missense	probably damaging	1.00
R5084:Notch3	UTSW	17	32157890	critical splice donor site	probably null
R5086:Notch3	UTSW	17	32143334	missense	probably benign	0.13
R5343:Notch3	UTSW	17	32143283	missense	probably benign	0.03
R5389:Notch3	UTSW	17	32139189	missense	probably benign
R5503:Notch3	UTSW	17	32147055	missense	probably benign	0.00
R5698:Notch3	UTSW	17	32157987	missense	probably damaging	1.00
R5824:Notch3	UTSW	17	32153861	missense	possibly damaging	0.92
R5969:Notch3	UTSW	17	32153884	missense	probably damaging	1.00
R6050:Notch3	UTSW	17	32143527	missense	probably benign
R6274:Notch3	UTSW	17	32147290	missense	probably benign
R6276:Notch3	UTSW	17	32154749	missense	probably benign	0.10
R6313:Notch3	UTSW	17	32151154	splice site	probably null
R6316:Notch3	UTSW	17	32137813	splice site	probably null
R6380:Notch3	UTSW	17	32144559	missense	probably damaging	1.00
R6401:Notch3	UTSW	17	32158623	missense	probably benign	0.01
R6502:Notch3	UTSW	17	32158217	missense	probably damaging	1.00
R6741:Notch3	UTSW	17	32143484	missense	probably benign	0.16
R7131:Notch3	UTSW	17	32144217	missense	probably benign
R7140:Notch3	UTSW	17	32156377	missense	possibly damaging	0.84
R7162:Notch3	UTSW	17	32146449	missense	probably damaging	0.98
R7171:Notch3	UTSW	17	32158962	missense	probably damaging	1.00
R7449:Notch3	UTSW	17	32157966	missense	probably damaging	1.00
R7450:Notch3	UTSW	17	32141391	missense	possibly damaging	0.69
R7554:Notch3	UTSW	17	32122371	missense	probably benign	0.03
R7575:Notch3	UTSW	17	32154819	missense	possibly damaging	0.81
R7632:Notch3	UTSW	17	32158506	missense	probably benign
R7633:Notch3	UTSW	17	32158622	missense	probably benign	0.17
R7860:Notch3	UTSW	17	32122773	missense	possibly damaging	0.67
R8052:Notch3	UTSW	17	32146571	missense	probably damaging	1.00
R8250:Notch3	UTSW	17	32132336	missense	probably damaging	1.00
R8296:Notch3	UTSW	17	32122739	missense	probably damaging	1.00
R8306:Notch3	UTSW	17	32158112	missense	probably damaging	0.99
R8458:Notch3	UTSW	17	32156050	missense	probably damaging	1.00
R8539:Notch3	UTSW	17	32156355	missense	possibly damaging	0.92
R8865:Notch3	UTSW	17	32122116	missense	probably benign	0.01
R8925:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R8927:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R9062:Notch3	UTSW	17	32122718	missense	possibly damaging	0.93
R9079:Notch3	UTSW	17	32164059	intron	probably benign
R9089:Notch3	UTSW	17	32151547	missense	probably benign	0.00
R9260:Notch3	UTSW	17	32143242	critical splice donor site	probably null
R9289:Notch3	UTSW	17	32158280	missense	probably damaging	1.00
R9294:Notch3	UTSW	17	32143691	missense	probably benign	0.03
R9661:Notch3	UTSW	17	32154818	missense	probably damaging	1.00
R9779:Notch3	UTSW	17	32153783	missense	probably damaging	1.00
T0975:Notch3	UTSW	17	32146417	missense	probably damaging	0.99
Z1088:Notch3	UTSW	17	32158652	missense	possibly damaging	0.94
Z1176:Notch3	UTSW	17	32141516	missense	probably benign	0.12
Z1176:Notch3	UTSW	17	32151370	missense	probably damaging	1.00
Z1177:Notch3	UTSW	17	32166694	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTACCAGGAAGGCAAGCAC -3'
(R):5'- CCCTTGGTAGGCGAGAATGTAG -3'

Sequencing Primer
(F):5'- CATATGTGACATCACTGCTCTGC -3'
(R):5'- GAGAATGTAGTCAGACCCAAGCTC -3'

Posted On

2015-02-18