Incidental Mutation 'R3434:Dpysl3'
ID266371
Institutional Source Beutler Lab
Gene Symbol Dpysl3
Ensembl Gene ENSMUSG00000024501
Gene Namedihydropyrimidinase-like 3
SynonymsTUC4, Ulip, Ulip1, CRMP-4
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location43320979-43438286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43361061 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 70 (V70I)
Ref Sequence ENSEMBL: ENSMUSP00000113711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025379] [ENSMUST00000118043] [ENSMUST00000121805]
Predicted Effect probably benign
Transcript: ENSMUST00000025379
AA Change: V72I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025379
Gene: ENSMUSG00000024501
AA Change: V72I

DomainStartEndE-ValueType
Pfam:Amidohydro_5 35 104 8e-13 PFAM
Pfam:Amidohydro_4 59 410 3.4e-14 PFAM
Pfam:Amidohydro_1 64 413 7.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118043
AA Change: V70I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113711
Gene: ENSMUSG00000024501
AA Change: V70I

DomainStartEndE-ValueType
Pfam:Amidohydro_5 33 102 2e-13 PFAM
Pfam:Amidohydro_4 57 408 8.8e-15 PFAM
Pfam:Amidohydro_1 62 411 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121805
AA Change: V185I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112928
Gene: ENSMUSG00000024501
AA Change: V185I

DomainStartEndE-ValueType
low complexity region 85 102 N/A INTRINSIC
Pfam:Amidohydro_1 177 566 1.4e-41 PFAM
Pfam:Amidohydro_3 481 566 1.2e-9 PFAM
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the TUC (TOAD-64/Ulip/CRMP) family of proteins. Members of this family are phosphoproteins that function in axonal guidance and neuronal differentiation during development and regeneration of the nervous system. A mutation in the human gene is associated with amyotrophic lateral sclerosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired axon extension, abnormal neuron growth cones morphology and impaired anterograde transportation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Dpysl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Dpysl3 APN 18 43358300 missense probably damaging 1.00
IGL02533:Dpysl3 APN 18 43325794 missense probably benign 0.00
IGL02632:Dpysl3 APN 18 43393025 missense possibly damaging 0.50
IGL03111:Dpysl3 APN 18 43329845 missense probably damaging 1.00
IGL03138:Dpysl3 UTSW 18 43325794 missense probably benign 0.00
R0001:Dpysl3 UTSW 18 43358375 missense possibly damaging 0.93
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0062:Dpysl3 UTSW 18 43333876 splice site probably null
R0656:Dpysl3 UTSW 18 43438071 missense possibly damaging 0.65
R1522:Dpysl3 UTSW 18 43363557 missense probably damaging 1.00
R1694:Dpysl3 UTSW 18 43328374 missense possibly damaging 0.94
R1764:Dpysl3 UTSW 18 43363518 missense probably damaging 1.00
R1822:Dpysl3 UTSW 18 43342328 missense probably benign 0.07
R1880:Dpysl3 UTSW 18 43329874 splice site probably null
R1907:Dpysl3 UTSW 18 43438128 missense probably damaging 1.00
R1925:Dpysl3 UTSW 18 43332931 missense probably damaging 1.00
R2248:Dpysl3 UTSW 18 43358293 missense possibly damaging 0.56
R4575:Dpysl3 UTSW 18 43342247 missense probably damaging 1.00
R4778:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4780:Dpysl3 UTSW 18 43354802 missense probably benign 0.06
R4858:Dpysl3 UTSW 18 43334014 missense probably damaging 0.96
R4987:Dpysl3 UTSW 18 43328427 missense probably benign 0.00
R5151:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5152:Dpysl3 UTSW 18 43438080 missense probably benign 0.00
R5229:Dpysl3 UTSW 18 43332951 missense probably damaging 1.00
R5373:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5374:Dpysl3 UTSW 18 43361036 missense probably damaging 1.00
R5383:Dpysl3 UTSW 18 43438038 missense probably damaging 1.00
R6014:Dpysl3 UTSW 18 43361067 missense probably damaging 1.00
R6837:Dpysl3 UTSW 18 43437882 missense probably benign 0.01
R6958:Dpysl3 UTSW 18 43438002 missense probably benign
R6991:Dpysl3 UTSW 18 43353891 missense probably damaging 1.00
R7087:Dpysl3 UTSW 18 43363530 missense probably damaging 1.00
R7196:Dpysl3 UTSW 18 43329845 missense probably damaging 1.00
R7223:Dpysl3 UTSW 18 43438042 missense probably benign 0.20
R8731:Dpysl3 UTSW 18 43438092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCATGAACCAAACTGAGAG -3'
(R):5'- ACAGTGCCATGCAGATGATG -3'

Sequencing Primer
(F):5'- CTGAGAGAAGTGTGTATAATTTCCG -3'
(R):5'- CTGGGGCAGTAGTTTTGGATAC -3'
Posted On2015-02-18