Incidental Mutation 'R3434:Rpgr'
ID266374
Institutional Source Beutler Lab
Gene Symbol Rpgr
Ensembl Gene ENSMUSG00000031174
Gene Nameretinitis pigmentosa GTPase regulator
SynonymsRp3h
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3434 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location10073621-10216920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10176602 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 656 (S656P)
Ref Sequence ENSEMBL: ENSMUSP00000037358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044598] [ENSMUST00000072393] [ENSMUST00000073392] [ENSMUST00000115532] [ENSMUST00000115533] [ENSMUST00000115534]
Predicted Effect probably benign
Transcript: ENSMUST00000044598
AA Change: S656P

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037358
Gene: ENSMUSG00000031174
AA Change: S656P

DomainStartEndE-ValueType
Pfam:RCC1 91 140 2.4e-12 PFAM
Pfam:RCC1 143 193 2.1e-7 PFAM
Pfam:RCC1_2 180 209 4.5e-11 PFAM
Pfam:RCC1 196 243 2.2e-12 PFAM
Pfam:RCC1 246 296 6.3e-13 PFAM
Pfam:RCC1 300 348 9.9e-13 PFAM
Pfam:RCC1 352 402 2.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 820 829 N/A INTRINSIC
low complexity region 879 897 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072393
SMART Domains Protein: ENSMUSP00000072229
Gene: ENSMUSG00000031174

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 3e-8 PFAM
Pfam:RCC1 91 140 3.1e-13 PFAM
Pfam:RCC1 143 193 7.5e-9 PFAM
Pfam:RCC1_2 180 209 1.5e-11 PFAM
Pfam:RCC1 196 243 2.6e-13 PFAM
Pfam:RCC1 246 296 4.4e-13 PFAM
Pfam:RCC1 300 348 1.7e-12 PFAM
Pfam:RCC1 352 402 1.3e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073392
SMART Domains Protein: ENSMUSP00000073106
Gene: ENSMUSG00000031174

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 3.3e-8 PFAM
Pfam:RCC1 91 140 3.5e-13 PFAM
Pfam:RCC1 143 193 8.4e-9 PFAM
Pfam:RCC1_2 180 209 1.7e-11 PFAM
Pfam:RCC1 196 243 3e-13 PFAM
Pfam:RCC1 246 296 4.9e-13 PFAM
Pfam:RCC1 300 348 1.9e-12 PFAM
Pfam:RCC1 352 402 1.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115532
AA Change: S656P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000111194
Gene: ENSMUSG00000031174
AA Change: S656P

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 1.1e-7 PFAM
Pfam:RCC1 91 140 1.3e-12 PFAM
Pfam:RCC1 143 193 3.1e-8 PFAM
Pfam:RCC1_2 180 209 5.5e-11 PFAM
Pfam:RCC1 196 243 1.1e-12 PFAM
Pfam:RCC1 246 296 1.8e-12 PFAM
Pfam:RCC1 300 348 6.8e-12 PFAM
Pfam:RCC1 352 402 5.4e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 754 766 N/A INTRINSIC
low complexity region 820 829 N/A INTRINSIC
low complexity region 879 897 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115533
SMART Domains Protein: ENSMUSP00000111195
Gene: ENSMUSG00000031174

DomainStartEndE-ValueType
Pfam:RCC1_2 76 104 7.1e-8 PFAM
Pfam:RCC1 91 140 8.4e-13 PFAM
Pfam:RCC1 143 193 2e-8 PFAM
Pfam:RCC1_2 180 209 3.7e-11 PFAM
Pfam:RCC1 196 243 7.1e-13 PFAM
Pfam:RCC1 246 296 1.2e-12 PFAM
Pfam:RCC1 300 348 4.4e-12 PFAM
Pfam:RCC1 352 402 3.5e-9 PFAM
low complexity region 433 460 N/A INTRINSIC
low complexity region 586 604 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115534
SMART Domains Protein: ENSMUSP00000111196
Gene: ENSMUSG00000031174

DomainStartEndE-ValueType
Pfam:RCC1 1 45 9.6e-11 PFAM
Pfam:RCC1 48 98 3.2e-8 PFAM
Pfam:RCC1_2 85 114 6.1e-11 PFAM
Pfam:RCC1 101 148 1.1e-12 PFAM
Pfam:RCC1 151 201 1.9e-12 PFAM
Pfam:RCC1 205 253 7.1e-12 PFAM
Pfam:RCC1 257 307 5.6e-9 PFAM
low complexity region 338 365 N/A INTRINSIC
low complexity region 491 509 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155734
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homo- and hemizygotes for an X-linked, targeted, null mutation exhibit ectopic placement of cone opsins, reduced levels of rhodopsin in rod cells, and partial degeneration of both cone and rod photoreceptors by 2-6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Rpgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Rpgr APN X 10208709 missense possibly damaging 0.63
IGL02394:Rpgr APN X 10166217 missense probably benign 0.30
IGL02401:Rpgr APN X 10158717 missense possibly damaging 0.78
R4598:Rpgr UTSW X 10196016 missense probably benign 0.00
R5732:Rpgr UTSW X 10166272 missense probably benign 0.12
R5734:Rpgr UTSW X 10166272 missense probably benign 0.12
Z1177:Rpgr UTSW X 10158704 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAAGGTCATATTCTGCTCACTGC -3'
(R):5'- CACCGTGCACTGAAAATGAG -3'

Sequencing Primer
(F):5'- AGGTCATATTCTGCTCACTGCTTCTC -3'
(R):5'- CACCGTGCACTGAAAATGAGGATAG -3'
Posted On2015-02-18