Incidental Mutation 'R2867:Zfpm2'
ID 266406
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
MMRRC Submission 040456-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2867 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 41099389 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 149 (A149V)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: A281V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: A281V

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230319
AA Change: A149V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss T C 1: 177,767,812 probably null Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Birc2 A C 9: 7,834,477 M1R probably null Het
Caprin2 G A 6: 148,846,240 silent Het
Cog4 C A 8: 110,866,659 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Ctnna2 T C 6: 77,114,922 probably benign Het
Cyp7a1 T C 4: 6,272,493 E240G probably damaging Het
Efhc2 A T X: 17,161,245 probably benign Homo
Epha6 T C 16: 59,960,296 probably null Het
Evc T A 5: 37,316,275 probably benign Het
Fbf1 A G 11: 116,161,448 probably benign Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Gtf3c4 A G 2: 28,839,904 probably benign Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Kif20b A G 19: 34,940,128 E631G probably damaging Het
Lctl T C 9: 64,137,868 S550P probably benign Het
Lrrc6 A T 15: 66,438,408 L337* probably null Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mgst2 A G 3: 51,664,533 silent Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp1 T C 8: 86,861,405 N302D probably benign Het
Pcdh7 A T 5: 57,721,894 K930N probably damaging Het
Pramef25 T A 4: 143,948,886 I457L probably benign Het
Proca1 A T 11: 78,204,980 N146I probably damaging Het
RP23-211L5.9 T C 6: 68,895,650 probably null Het
Ryr2 A T 13: 11,761,349 W1101R probably damaging Het
Slc35d3 T C 10: 19,849,463 T216A probably benign Het
Terb1 C T 8: 104,447,853 probably benign Het
Thnsl2 C A 6: 71,131,961 D289Y probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Tradd G T 8: 105,259,513 F182L probably benign Het
Trav17 A T 14: 53,806,926 Y50F probably benign Het
Usp37 A T 1: 74,450,532 D808E probably damaging Het
Usp42 G A 5: 143,715,464 P935S possibly damaging Het
Vmn2r23 A G 6: 123,713,164 D333G possibly damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 41099316 missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCTGACCTGCCAAAGATGC -3'
(R):5'- AAAAGAACACTGCTTGGTTCAG -3'

Sequencing Primer
(F):5'- TGCAAGATCATAATCACTGATGCTCC -3'
(R):5'- CACTGCTTGGTTCAGTAAAATTATG -3'
Posted On 2015-02-18