Incidental Mutation 'R2867:Zfpm2'
ID 266406
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms FOG2, B330005D23Rik, FOG-2
MMRRC Submission 040456-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2867 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 40518438-40967988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40962785 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 149 (A149V)
Ref Sequence ENSEMBL: ENSMUSP00000155094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect probably benign
Transcript: ENSMUST00000053467
AA Change: A281V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: A281V

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230319
AA Change: A149V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss2 T C 1: 177,595,378 (GRCm39) probably null Het
Arid3c T C 4: 41,725,958 (GRCm39) D215G probably damaging Het
Birc2 A C 9: 7,834,478 (GRCm39) M1R probably null Het
Caprin2 G A 6: 148,747,738 (GRCm39) silent Het
Cog4 C A 8: 111,593,291 (GRCm39) probably benign Het
Cpz T C 5: 35,659,705 (GRCm39) K647E probably benign Het
Ctnna2 T C 6: 77,091,905 (GRCm39) probably benign Het
Cyp7a1 T C 4: 6,272,493 (GRCm39) E240G probably damaging Het
Dnaaf11 A T 15: 66,310,257 (GRCm39) L337* probably null Het
Efhc2 A T X: 17,027,484 (GRCm39) probably benign Homo
Epha6 T C 16: 59,780,659 (GRCm39) probably null Het
Evc T A 5: 37,473,619 (GRCm39) probably benign Het
Fbf1 A G 11: 116,052,274 (GRCm39) probably benign Het
Grin2b A G 6: 135,710,637 (GRCm39) F970L probably damaging Het
Gtf3c4 A G 2: 28,729,916 (GRCm39) probably benign Het
Kcnma1 A T 14: 23,423,275 (GRCm39) N682K probably benign Het
Kif20b A G 19: 34,917,528 (GRCm39) E631G probably damaging Het
Lctl T C 9: 64,045,150 (GRCm39) S550P probably benign Het
Mapk10 C T 5: 103,186,548 (GRCm39) D25N probably benign Het
Mgst2 A G 3: 51,571,954 (GRCm39) silent Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
N4bp1 T C 8: 87,588,033 (GRCm39) N302D probably benign Het
Pcdh7 A T 5: 57,879,236 (GRCm39) K930N probably damaging Het
Pramel16 T A 4: 143,675,456 (GRCm39) I457L probably benign Het
Proca1 A T 11: 78,095,806 (GRCm39) N146I probably damaging Het
RP23-211L5.9 T C 6: 68,872,634 (GRCm39) probably null Het
Ryr2 A T 13: 11,776,235 (GRCm39) W1101R probably damaging Het
Slc35d3 T C 10: 19,725,209 (GRCm39) T216A probably benign Het
Terb1 C T 8: 105,174,485 (GRCm39) probably benign Het
Thnsl2 C A 6: 71,108,945 (GRCm39) D289Y probably damaging Het
Tigd4 A G 3: 84,501,259 (GRCm39) N59D possibly damaging Het
Togaram2 T C 17: 72,016,592 (GRCm39) S649P probably benign Het
Tradd G T 8: 105,986,145 (GRCm39) F182L probably benign Het
Trav17 A T 14: 54,044,383 (GRCm39) Y50F probably benign Het
Usp37 A T 1: 74,489,691 (GRCm39) D808E probably damaging Het
Usp42 G A 5: 143,701,219 (GRCm39) P935S possibly damaging Het
Vmn2r23 A G 6: 123,690,123 (GRCm39) D333G possibly damaging Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 40,962,683 (GRCm39) missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 40,962,887 (GRCm39) missense probably benign 0.37
IGL00821:Zfpm2 APN 15 40,966,783 (GRCm39) missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01623:Zfpm2 APN 15 40,965,320 (GRCm39) missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40,616,452 (GRCm39) critical splice donor site probably null
IGL01872:Zfpm2 APN 15 40,965,783 (GRCm39) missense probably benign
IGL02087:Zfpm2 APN 15 40,966,517 (GRCm39) missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 40,965,591 (GRCm39) missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 40,962,890 (GRCm39) missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 40,962,868 (GRCm39) missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 40,965,415 (GRCm39) missense probably benign 0.23
IGL02792:Zfpm2 APN 15 40,966,409 (GRCm39) missense probably benign 0.00
IGL02861:Zfpm2 APN 15 40,966,662 (GRCm39) missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 40,964,790 (GRCm39) missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 40,966,170 (GRCm39) missense probably benign
R0305:Zfpm2 UTSW 15 40,637,431 (GRCm39) splice site probably benign
R0365:Zfpm2 UTSW 15 40,637,462 (GRCm39) missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 40,965,075 (GRCm39) missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 40,965,877 (GRCm39) missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 40,962,687 (GRCm39) missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 40,966,605 (GRCm39) missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 40,966,419 (GRCm39) missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 40,964,579 (GRCm39) missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 40,962,785 (GRCm39) missense probably benign 0.06
R2886:Zfpm2 UTSW 15 40,965,719 (GRCm39) missense probably benign 0.44
R3024:Zfpm2 UTSW 15 40,966,355 (GRCm39) missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40,734,023 (GRCm39) missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 40,966,940 (GRCm39) missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 40,959,557 (GRCm39) missense probably benign 0.00
R5263:Zfpm2 UTSW 15 40,962,791 (GRCm39) missense probably benign 0.45
R5266:Zfpm2 UTSW 15 40,962,865 (GRCm39) missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40,733,938 (GRCm39) missense probably benign 0.01
R5584:Zfpm2 UTSW 15 40,965,933 (GRCm39) missense probably benign 0.45
R5661:Zfpm2 UTSW 15 40,959,467 (GRCm39) nonsense probably null
R6437:Zfpm2 UTSW 15 40,962,793 (GRCm39) missense probably benign
R6660:Zfpm2 UTSW 15 40,518,981 (GRCm39) critical splice donor site probably null
R6742:Zfpm2 UTSW 15 40,965,114 (GRCm39) missense probably benign
R6749:Zfpm2 UTSW 15 40,818,104 (GRCm39) missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40,616,413 (GRCm39) missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 40,966,386 (GRCm39) missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 40,966,671 (GRCm39) missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40,818,162 (GRCm39) missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 40,959,487 (GRCm39) missense probably benign 0.03
R7893:Zfpm2 UTSW 15 40,966,008 (GRCm39) missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 40,965,644 (GRCm39) missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40,616,355 (GRCm39) missense probably benign 0.34
R9028:Zfpm2 UTSW 15 40,966,758 (GRCm39) missense possibly damaging 0.87
R9065:Zfpm2 UTSW 15 40,962,712 (GRCm39) missense possibly damaging 0.95
R9234:Zfpm2 UTSW 15 40,966,470 (GRCm39) missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 40,966,867 (GRCm39) missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 40,965,710 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCTGACCTGCCAAAGATGC -3'
(R):5'- AAAAGAACACTGCTTGGTTCAG -3'

Sequencing Primer
(F):5'- TGCAAGATCATAATCACTGATGCTCC -3'
(R):5'- CACTGCTTGGTTCAGTAAAATTATG -3'
Posted On 2015-02-18