Mutagenetix > Incidental Mutation

Incidental Mutation 'R2867:Epha6'

266408

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

040456-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2867 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

splice site (38 bp from exon)

DNA Base Change (assembly)

T to C at 59960296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860] [ENSMUST00000161358]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000068860

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161358

SMART Domains

Protein: ENSMUSP00000124340
Gene: ENSMUSG00000055540

Domain	Start	End	E-Value	Type
Pfam:EphA2_TM	9	88	1.2e-26	PFAM
Pfam:Pkinase_Tyr	91	183	3e-18	PFAM
Pfam:Pkinase	91	296	1.5e-29	PFAM
Pfam:Pkinase_Tyr	179	295	6e-31	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (30/31)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adss	T	C	1: 177,767,812		probably null	Het
Arid3c	T	C	4: 41,725,958	D215G	probably damaging	Het
Birc2	A	C	9: 7,834,477	M1R	probably null	Het
Caprin2	G	A	6: 148,846,240		silent	Het
Cog4	C	A	8: 110,866,659		probably benign	Het
Cpz	T	C	5: 35,502,361	K647E	probably benign	Het
Ctnna2	T	C	6: 77,114,922		probably benign	Het
Cyp7a1	T	C	4: 6,272,493	E240G	probably damaging	Het
Efhc2	A	T	X: 17,161,245		probably benign	Homo
Evc	T	A	5: 37,316,275		probably benign	Het
Fbf1	A	G	11: 116,161,448		probably benign	Het
Grin2b	A	G	6: 135,733,639	F970L	probably damaging	Het
Gtf3c4	A	G	2: 28,839,904		probably benign	Het
Kcnma1	A	T	14: 23,373,207	N682K	probably benign	Het
Kif20b	A	G	19: 34,940,128	E631G	probably damaging	Het
Lctl	T	C	9: 64,137,868	S550P	probably benign	Het
Lrrc6	A	T	15: 66,438,408	L337*	probably null	Het
Mapk10	C	T	5: 103,038,682	D25N	probably benign	Het
Mgst2	A	G	3: 51,664,533		silent	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
N4bp1	T	C	8: 86,861,405	N302D	probably benign	Het
Pcdh7	A	T	5: 57,721,894	K930N	probably damaging	Het
Pramef25	T	A	4: 143,948,886	I457L	probably benign	Het
Proca1	A	T	11: 78,204,980	N146I	probably damaging	Het
RP23-211L5.9	T	C	6: 68,895,650		probably null	Het
Ryr2	A	T	13: 11,761,349	W1101R	probably damaging	Het
Slc35d3	T	C	10: 19,849,463	T216A	probably benign	Het
Terb1	C	T	8: 104,447,853		probably benign	Het
Thnsl2	C	A	6: 71,131,961	D289Y	probably damaging	Het
Tigd4	A	G	3: 84,593,952	N59D	possibly damaging	Het
Togaram2	T	C	17: 71,709,597	S649P	probably benign	Het
Tradd	G	T	8: 105,259,513	F182L	probably benign	Het
Trav17	A	T	14: 53,806,926	Y50F	probably benign	Het
Usp37	A	T	1: 74,450,532	D808E	probably damaging	Het
Usp42	G	A	5: 143,715,464	P935S	possibly damaging	Het
Vmn2r23	A	G	6: 123,713,164	D333G	possibly damaging	Het
Zfpm2	C	T	15: 41,099,389	A149V	probably benign	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00
R8794:Epha6	UTSW	16	60205672	missense	probably benign	0.00
R8926:Epha6	UTSW	16	59839299	missense	probably benign	0.11
R9166:Epha6	UTSW	16	60604875	missense	probably benign	0.00
R9265:Epha6	UTSW	16	59655754	missense	probably damaging	1.00
R9322:Epha6	UTSW	16	60424755	missense	probably damaging	1.00
R9442:Epha6	UTSW	16	60205487	missense	probably benign	0.26
R9742:Epha6	UTSW	16	60205702	missense	probably damaging	1.00
Z1188:Epha6	UTSW	16	59654090	missense	probably damaging	1.00
Z1189:Epha6	UTSW	16	59654090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAAAACCCTTTAAGGAGTCATC -3'
(R):5'- AAGTGTCCCCTGTGTCTGTG -3'

Sequencing Primer
(F):5'- GAGTAAGTTATCCTTTAGTACTTGGC -3'
(R):5'- GTTTCAGCTTCTGACATGGC -3'

Posted On

2015-02-18