Incidental Mutation 'R2869:Plcl1'
ID266413
Institutional Source Beutler Lab
Gene Symbol Plcl1
Ensembl Gene ENSMUSG00000038349
Gene Namephospholipase C-like 1
SynonymsPRIP-1, C230017K02Rik, PLC-L
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location55405921-55754285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55697150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 550 (D550V)
Ref Sequence ENSEMBL: ENSMUSP00000037854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042986]
Predicted Effect probably benign
Transcript: ENSMUST00000042986
AA Change: D550V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: D550V

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
PH 115 226 6.98e-4 SMART
low complexity region 301 310 N/A INTRINSIC
Pfam:EF-hand_like 316 398 5.9e-27 PFAM
PLCXc 399 543 2.13e-82 SMART
low complexity region 550 564 N/A INTRINSIC
PLCYc 586 702 2.15e-69 SMART
C2 723 829 1.02e-21 SMART
low complexity region 1080 1092 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187059
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Carmil1 G A 13: 24,045,068 silent Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gm26902 T A 19: 34,474,810 H106L probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Habp2 T A 19: 56,287,991 probably benign Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
March8 C T 6: 116,401,145 probably benign Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Plcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Plcl1 APN 1 55406536 missense probably benign
IGL00491:Plcl1 APN 1 55713498 critical splice donor site probably null
IGL00753:Plcl1 APN 1 55696738 missense probably damaging 1.00
IGL01415:Plcl1 APN 1 55696396 missense possibly damaging 0.92
IGL03024:Plcl1 APN 1 55695787 missense probably damaging 1.00
K3955:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
PIT4791001:Plcl1 UTSW 1 55701931 missense probably benign 0.03
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0083:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R0086:Plcl1 UTSW 1 55715583 missense probably damaging 1.00
R0092:Plcl1 UTSW 1 55696765 missense probably damaging 0.98
R0108:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R1716:Plcl1 UTSW 1 55695838 missense probably damaging 0.99
R2061:Plcl1 UTSW 1 55751345 missense probably benign 0.01
R2128:Plcl1 UTSW 1 55697838 missense probably damaging 1.00
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2873:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R3819:Plcl1 UTSW 1 55696599 missense probably benign
R3974:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R3975:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R4214:Plcl1 UTSW 1 55751335 nonsense probably null
R4400:Plcl1 UTSW 1 55715577 missense probably damaging 1.00
R4452:Plcl1 UTSW 1 55696886 missense probably benign 0.00
R4615:Plcl1 UTSW 1 55698134 missense probably benign 0.00
R5060:Plcl1 UTSW 1 55696512 missense possibly damaging 0.84
R5422:Plcl1 UTSW 1 55697384 missense probably benign 0.00
R5568:Plcl1 UTSW 1 55696150 missense possibly damaging 0.82
R5781:Plcl1 UTSW 1 55695989 missense possibly damaging 0.92
R5809:Plcl1 UTSW 1 55696001 missense probably damaging 1.00
R6009:Plcl1 UTSW 1 55696246 missense probably damaging 1.00
R6339:Plcl1 UTSW 1 55696315 missense probably damaging 1.00
R6431:Plcl1 UTSW 1 55697252 missense probably benign 0.03
R6534:Plcl1 UTSW 1 55696748 missense probably damaging 1.00
R6565:Plcl1 UTSW 1 55697958 nonsense probably null
R6678:Plcl1 UTSW 1 55695776 missense probably benign 0.13
R6773:Plcl1 UTSW 1 55751302 missense probably benign 0.03
R6925:Plcl1 UTSW 1 55406598 nonsense probably null
R7168:Plcl1 UTSW 1 55697463 missense probably damaging 1.00
R7256:Plcl1 UTSW 1 55698218 missense probably benign 0.45
R7522:Plcl1 UTSW 1 55696364 missense probably benign 0.31
R7527:Plcl1 UTSW 1 55697114 missense probably damaging 1.00
R7536:Plcl1 UTSW 1 55713481 nonsense probably null
R7585:Plcl1 UTSW 1 55406449 missense probably benign 0.00
R7591:Plcl1 UTSW 1 55697449 missense probably benign 0.01
R7689:Plcl1 UTSW 1 55697468 missense probably damaging 1.00
R8029:Plcl1 UTSW 1 55696078 missense probably benign 0.26
Z1176:Plcl1 UTSW 1 55696040 missense probably benign 0.20
Z1176:Plcl1 UTSW 1 55751284 nonsense probably null
Z1177:Plcl1 UTSW 1 55696884 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAATCACTGCTCTCTGCCTCAG -3'
(R):5'- ATTCATTGGCAATCCGGCTG -3'

Sequencing Primer
(F):5'- TGCCTCAGCAGAAAGTCATG -3'
(R):5'- GAACACATTTCCCAGTAGTTTTGG -3'
Posted On2015-02-18