Incidental Mutation 'R2869:Serinc2'
ID266431
Institutional Source Beutler Lab
Gene Symbol Serinc2
Ensembl Gene ENSMUSG00000023232
Gene Nameserine incorporator 2
SynonymsFKSG84, 2310004K20Rik, TDE2, Tde2l
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2869 (G1)
Quality Score159
Status Not validated
Chromosome4
Chromosomal Location130253495-130279205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130265212 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 29 (S29P)
Ref Sequence ENSEMBL: ENSMUSP00000113044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105996] [ENSMUST00000120126] [ENSMUST00000122374] [ENSMUST00000146478] [ENSMUST00000154846]
Predicted Effect probably benign
Transcript: ENSMUST00000105996
AA Change: S20P

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101618
Gene: ENSMUSG00000023232
AA Change: S20P

DomainStartEndE-ValueType
Pfam:Serinc 15 449 4.1e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120126
AA Change: S29P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113044
Gene: ENSMUSG00000023232
AA Change: S29P

DomainStartEndE-ValueType
Pfam:Serinc 25 457 1.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122374
SMART Domains Protein: ENSMUSP00000112535
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 394 2.9e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146478
SMART Domains Protein: ENSMUSP00000115198
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 148 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154846
SMART Domains Protein: ENSMUSP00000116586
Gene: ENSMUSG00000023232

DomainStartEndE-ValueType
Pfam:Serinc 1 82 3.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Carmil1 G A 13: 24,045,068 silent Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gm26902 T A 19: 34,474,810 H106L probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Habp2 T A 19: 56,287,991 probably benign Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
March8 C T 6: 116,401,145 probably benign Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Serinc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Serinc2 APN 4 130264408 missense possibly damaging 0.88
IGL02031:Serinc2 APN 4 130264444 nonsense probably null
IGL02551:Serinc2 APN 4 130260774 missense probably benign 0.01
R1455:Serinc2 UTSW 4 130264340 missense probably damaging 0.96
R1520:Serinc2 UTSW 4 130260750 missense probably benign 0.00
R2059:Serinc2 UTSW 4 130260785 missense probably damaging 1.00
R2869:Serinc2 UTSW 4 130265212 missense probably damaging 1.00
R3160:Serinc2 UTSW 4 130260735 missense probably benign
R3162:Serinc2 UTSW 4 130260735 missense probably benign
R4497:Serinc2 UTSW 4 130254054 missense possibly damaging 0.67
R4735:Serinc2 UTSW 4 130263645 missense probably benign 0.13
R4987:Serinc2 UTSW 4 130263027 splice site probably null
R5569:Serinc2 UTSW 4 130278479 missense probably benign 0.17
R5681:Serinc2 UTSW 4 130265076 missense probably damaging 1.00
R5946:Serinc2 UTSW 4 130255521 missense possibly damaging 0.91
R6556:Serinc2 UTSW 4 130258271 missense probably damaging 1.00
R6898:Serinc2 UTSW 4 130255442 missense probably benign 0.13
R7264:Serinc2 UTSW 4 130258259 missense probably benign 0.00
R7526:Serinc2 UTSW 4 130258790 missense probably benign 0.03
R7835:Serinc2 UTSW 4 130275487 missense unknown
Z1176:Serinc2 UTSW 4 130253995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTACCTGGAACGTCAACC -3'
(R):5'- TGGATTCCGGTTCAGTCCTAG -3'

Sequencing Primer
(F):5'- ACCTTACCTTGCCTGTGGAAG -3'
(R):5'- ATTCCGGTTCAGTCCTAGCTAGAAG -3'
Posted On2015-02-18