Incidental Mutation 'R2869:Nomo1'
ID266441
Institutional Source Beutler Lab
Gene Symbol Nomo1
Ensembl Gene ENSMUSG00000030835
Gene Namenodal modulator 1
SynonymsPM5, D7Ertd156e, Nomo
MMRRC Submission 040457-MU
Accession Numbers

NCBI RefSeq: NM_153057.4; MGI: 2385850

Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46033698-46084212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46046937 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 293 (T293N)
Ref Sequence ENSEMBL: ENSMUSP00000033121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033121]
Predicted Effect probably damaging
Transcript: ENSMUST00000033121
AA Change: T293N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033121
Gene: ENSMUSG00000030835
AA Change: T293N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
internal_repeat_1 22 215 2.35e-7 PROSPERO
Pfam:CarboxypepD_reg 322 395 3.5e-12 PFAM
Pfam:DUF2012 331 401 5.7e-10 PFAM
low complexity region 709 732 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
Blast:FN3 913 1017 6e-22 BLAST
low complexity region 1156 1164 N/A INTRINSIC
low complexity region 1203 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182564
Meta Mutation Damage Score 0.3060 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Carmil1 G A 13: 24,045,068 silent Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gm26902 T A 19: 34,474,810 H106L probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Habp2 T A 19: 56,287,991 probably benign Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
March8 C T 6: 116,401,145 probably benign Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Nomo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Nomo1 APN 7 46045336 missense possibly damaging 0.66
IGL00811:Nomo1 APN 7 46083308 missense possibly damaging 0.95
IGL01710:Nomo1 APN 7 46038556 missense probably damaging 1.00
IGL01797:Nomo1 APN 7 46056662 missense probably damaging 0.96
IGL01973:Nomo1 APN 7 46083227 splice site probably benign
IGL02506:Nomo1 APN 7 46078056 missense possibly damaging 0.50
IGL02739:Nomo1 APN 7 46044307 splice site probably null
IGL02863:Nomo1 APN 7 46046916 missense probably damaging 0.98
P0005:Nomo1 UTSW 7 46037557 critical splice acceptor site probably null
PIT4243001:Nomo1 UTSW 7 46044281 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0124:Nomo1 UTSW 7 46083228 splice site probably benign
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0417:Nomo1 UTSW 7 46068698 missense possibly damaging 0.51
R0467:Nomo1 UTSW 7 46072487 splice site probably null
R0535:Nomo1 UTSW 7 46072517 missense probably damaging 0.99
R0829:Nomo1 UTSW 7 46076172 splice site probably benign
R0940:Nomo1 UTSW 7 46033905 missense possibly damaging 0.56
R1480:Nomo1 UTSW 7 46060913 missense probably damaging 0.98
R1601:Nomo1 UTSW 7 46046955 missense probably damaging 0.96
R1743:Nomo1 UTSW 7 46070037 critical splice donor site probably null
R1765:Nomo1 UTSW 7 46066293 missense possibly damaging 0.59
R1861:Nomo1 UTSW 7 46078101 missense probably benign 0.06
R1998:Nomo1 UTSW 7 46033944 missense possibly damaging 0.69
R1999:Nomo1 UTSW 7 46056727 missense possibly damaging 0.95
R2145:Nomo1 UTSW 7 46066504 missense probably damaging 1.00
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2873:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R4116:Nomo1 UTSW 7 46033896 missense probably benign 0.06
R4404:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4406:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4560:Nomo1 UTSW 7 46041480 missense probably damaging 0.99
R4633:Nomo1 UTSW 7 46050260 splice site probably benign
R4651:Nomo1 UTSW 7 46068442 missense probably damaging 0.99
R4653:Nomo1 UTSW 7 46061813 missense probably benign 0.01
R4752:Nomo1 UTSW 7 46057202 missense probably damaging 1.00
R4792:Nomo1 UTSW 7 46044219 splice site probably null
R4838:Nomo1 UTSW 7 46083715 missense unknown
R4876:Nomo1 UTSW 7 46066491 missense probably damaging 1.00
R4915:Nomo1 UTSW 7 46044232 missense probably benign 0.30
R4953:Nomo1 UTSW 7 46050731 intron probably benign
R5463:Nomo1 UTSW 7 46063002 missense possibly damaging 0.47
R5664:Nomo1 UTSW 7 46076157 missense probably benign
R5956:Nomo1 UTSW 7 46042613 missense possibly damaging 0.51
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6307:Nomo1 UTSW 7 46033836 unclassified probably benign
R6695:Nomo1 UTSW 7 46066461 missense probably benign 0.16
R6970:Nomo1 UTSW 7 46045967 missense probably damaging 0.97
R7334:Nomo1 UTSW 7 46083268 missense probably damaging 1.00
R7394:Nomo1 UTSW 7 46066479 missense probably benign 0.26
R7556:Nomo1 UTSW 7 46066218 missense probably damaging 1.00
R7834:Nomo1 UTSW 7 46056738 critical splice donor site probably null
R7917:Nomo1 UTSW 7 46056738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACACTTAGGTTGCAAGTGGGTC -3'
(R):5'- AGTACACCTATGGTACCCCG -3'

Sequencing Primer
(F):5'- TCACAGTAGAGTGCAAGGCTTCTC -3'
(R):5'- ACTGCATGCGGTCCCATTTC -3'
Posted On2015-02-18