Incidental Mutation 'R2869:Pes1'
ID266453
Institutional Source Beutler Lab
Gene Symbol Pes1
Ensembl Gene ENSMUSG00000020430
Gene Namepescadillo ribosomal biogenesis factor 1
Synonyms
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3963975-3980004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3976834 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 372 (T372K)
Ref Sequence ENSEMBL: ENSMUSP00000105612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]
Predicted Effect probably benign
Transcript: ENSMUST00000020705
AA Change: T368K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430
AA Change: T368K

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109985
AA Change: T372K

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430
AA Change: T372K

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137544
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Carmil1 G A 13: 24,045,068 silent Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gm26902 T A 19: 34,474,810 H106L probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Habp2 T A 19: 56,287,991 probably benign Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
March8 C T 6: 116,401,145 probably benign Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Pes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Pes1 APN 11 3976803 missense probably damaging 1.00
IGL01448:Pes1 APN 11 3977979 missense possibly damaging 0.89
H8441:Pes1 UTSW 11 3977636 small deletion probably benign
R0634:Pes1 UTSW 11 3977794 splice site probably benign
R0634:Pes1 UTSW 11 3977795 splice site probably benign
R0883:Pes1 UTSW 11 3975557 missense probably damaging 1.00
R0980:Pes1 UTSW 11 3977636 small deletion probably benign
R1435:Pes1 UTSW 11 3976075 missense probably benign 0.00
R1557:Pes1 UTSW 11 3976824 missense probably damaging 1.00
R1694:Pes1 UTSW 11 3977719 small deletion probably benign
R1885:Pes1 UTSW 11 3969482 missense probably damaging 1.00
R1929:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2270:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2272:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2362:Pes1 UTSW 11 3977123 missense probably damaging 1.00
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2873:Pes1 UTSW 11 3976834 missense probably benign 0.05
R3024:Pes1 UTSW 11 3977719 small deletion probably benign
R3039:Pes1 UTSW 11 3975547 missense probably damaging 1.00
R3195:Pes1 UTSW 11 3975736 splice site probably benign
R3773:Pes1 UTSW 11 3975548 missense probably damaging 1.00
R4590:Pes1 UTSW 11 3977986 missense probably damaging 1.00
R4739:Pes1 UTSW 11 3964058 missense probably damaging 1.00
R5396:Pes1 UTSW 11 3977719 small deletion probably benign
R6016:Pes1 UTSW 11 3978004 missense possibly damaging 0.68
R6351:Pes1 UTSW 11 3978865 missense probably benign
R6921:Pes1 UTSW 11 3973330 missense probably damaging 0.98
R7315:Pes1 UTSW 11 3976085 missense probably benign 0.00
R8178:Pes1 UTSW 11 3977718 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAGTGTAGTTGTTATCCCAG -3'
(R):5'- ACATAGTACCTGGTGCAGAGC -3'

Sequencing Primer
(F):5'- GTTGTTATCCCAGACAGAAGACTC -3'
(R):5'- TGCAGAGCAGCCAAAGAAATGTC -3'
Posted On2015-02-18