Mutagenetix > Incidental Mutation

Incidental Mutation 'R2869:Dhx57'

266468

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

MMRRC Submission

040457-MU

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R2869 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80251376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1051 (D1051E)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably benign
Transcript: ENSMUST00000038166
AA Change: D998E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: D998E

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086555
AA Change: D1051E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: D1051E

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Meta Mutation Damage Score

0.0755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2	A	G	1: 59,211,137	S483P	probably damaging	Het
C030034I22Rik	T	A	17: 69,418,111		noncoding transcript	Het
Carmil1	G	A	13: 24,045,068		silent	Het
Ccl27a	C	T	4: 41,769,640	R73Q	probably benign	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Fam19a2	A	T	10: 123,704,365	H42L	possibly damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Homo
Gbp11	C	T	5: 105,331,000	D191N	probably benign	Het
Ggt6	A	T	11: 72,437,361	N229I	probably benign	Het
Gm26902	T	A	19: 34,474,810	H106L	probably benign	Het
Gm37340	G	A	2: 6,950,928		probably benign	Het
Gm9874	A	T	17: 30,485,789		probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Gsdme	A	T	6: 50,208,177	C432*	probably null	Het
Habp2	T	A	19: 56,287,991		probably benign	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Kcnb1	A	G	2: 167,105,935	L331P	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Homo
Krt13	A	G	11: 100,117,649	S421P	unknown	Het
Lactbl1	G	A	4: 136,626,786	C37Y	probably damaging	Het
Lzts2	C	A	19: 45,024,095	S321*	probably null	Het
March8	C	T	6: 116,401,145		probably benign	Het
Meikin	T	C	11: 54,373,507	V103A	possibly damaging	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678	P65L	possibly damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nav1	A	G	1: 135,460,757		silent	Het
Nbn	T	A	4: 15,963,810	D70E	probably damaging	Het
Nell1	A	T	7: 50,249,657		probably benign	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Nwd2	A	T	5: 63,800,328	I334L	probably benign	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr730	T	C	14: 50,186,354	T288A	probably benign	Het
Olfr801	A	T	10: 129,669,759	C253*	probably null	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Otud4	T	A	8: 79,661,073	N300K	possibly damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Plcl1	A	T	1: 55,697,150	D550V	probably benign	Het
Ppp1r7	T	A	1: 93,357,863		probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Homo
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Pzp	A	T	6: 128,485,556		probably null	Het
Serinc2	A	G	4: 130,265,212	S29P	probably damaging	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
St7	C	T	6: 17,819,277	P60L	probably damaging	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Taf6l	A	G	19: 8,778,628		probably benign	Het
Tnni3k	C	T	3: 154,938,750		probably null	Het
Tprg	T	C	16: 25,412,840	W189R	probably damaging	Het
Trim32	A	G	4: 65,614,457	D417G	probably damaging	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Ybx3	G	A	6: 131,370,413	A253V	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het
Zzz3	T	A	3: 152,446,844		silent	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9212:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9447:Dhx57	UTSW	17	80242094	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGATCCCTTTGAGAACTGTGAC -3'
(R):5'- AACAAAAGATCCCTCTGCTTCATTC -3'

Sequencing Primer
(F):5'- CTTTGAGAACTGTGACATAAAATTCC -3'
(R):5'- AAGATCCCTCTGCTTCATTCTACCAG -3'

Posted On

2015-02-18