Mutagenetix > Incidental Mutation

Incidental Mutation 'R2869:Mpp7'

266469

Institutional Source

Beutler Lab

Gene Symbol

Mpp7

Ensembl Gene

ENSMUSG00000057440

Gene Name

membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

Synonyms

2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik

MMRRC Submission

040457-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R2869 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7347962-7626863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 7461678 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 65 (P65L)

Ref Sequence

ENSEMBL: ENSMUSP00000111535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115869]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115869
AA Change: P65L

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: P65L

Domain	Start	End	E-Value	Type
L27	10	68	7.05e-14	SMART
L27	72	125	3.72e-13	SMART
PDZ	147	220	3.8e-15	SMART
SH3	231	297	1.4e-11	SMART
low complexity region	317	328	N/A	INTRINSIC
GuKc	367	563	4.01e-65	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2	A	G	1: 59,211,137	S483P	probably damaging	Het
C030034I22Rik	T	A	17: 69,418,111		noncoding transcript	Het
Carmil1	G	A	13: 24,045,068		silent	Het
Ccl27a	C	T	4: 41,769,640	R73Q	probably benign	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Fam19a2	A	T	10: 123,704,365	H42L	possibly damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Homo
Gbp11	C	T	5: 105,331,000	D191N	probably benign	Het
Ggt6	A	T	11: 72,437,361	N229I	probably benign	Het
Gm26902	T	A	19: 34,474,810	H106L	probably benign	Het
Gm37340	G	A	2: 6,950,928		probably benign	Het
Gm9874	A	T	17: 30,485,789		probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Gsdme	A	T	6: 50,208,177	C432*	probably null	Het
Habp2	T	A	19: 56,287,991		probably benign	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Kcnb1	A	G	2: 167,105,935	L331P	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Homo
Krt13	A	G	11: 100,117,649	S421P	unknown	Het
Lactbl1	G	A	4: 136,626,786	C37Y	probably damaging	Het
Lzts2	C	A	19: 45,024,095	S321*	probably null	Het
March8	C	T	6: 116,401,145		probably benign	Het
Meikin	T	C	11: 54,373,507	V103A	possibly damaging	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nav1	A	G	1: 135,460,757		silent	Het
Nbn	T	A	4: 15,963,810	D70E	probably damaging	Het
Nell1	A	T	7: 50,249,657		probably benign	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Nwd2	A	T	5: 63,800,328	I334L	probably benign	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr730	T	C	14: 50,186,354	T288A	probably benign	Het
Olfr801	A	T	10: 129,669,759	C253*	probably null	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Otud4	T	A	8: 79,661,073	N300K	possibly damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Plcl1	A	T	1: 55,697,150	D550V	probably benign	Het
Ppp1r7	T	A	1: 93,357,863		probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Homo
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Pzp	A	T	6: 128,485,556		probably null	Het
Serinc2	A	G	4: 130,265,212	S29P	probably damaging	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
St7	C	T	6: 17,819,277	P60L	probably damaging	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Taf6l	A	G	19: 8,778,628		probably benign	Het
Tnni3k	C	T	3: 154,938,750		probably null	Het
Tprg	T	C	16: 25,412,840	W189R	probably damaging	Het
Trim32	A	G	4: 65,614,457	D417G	probably damaging	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Ybx3	G	A	6: 131,370,413	A253V	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het
Zzz3	T	A	3: 152,446,844		silent	Het

Other mutations in Mpp7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mpp7	APN	18	7353297	missense	probably benign	0.00
IGL01575:Mpp7	APN	18	7403365	splice site	probably benign
IGL02973:Mpp7	APN	18	7403297	missense	probably damaging	1.00
IGL02985:Mpp7	APN	18	7461637	critical splice donor site	probably null
IGL03224:Mpp7	APN	18	7403269	missense	probably benign	0.28
IGL03248:Mpp7	APN	18	7403269	missense	probably benign	0.28
R0040:Mpp7	UTSW	18	7403180	splice site	probably benign
R0089:Mpp7	UTSW	18	7439555	splice site	probably benign
R1413:Mpp7	UTSW	18	7350977	missense	probably damaging	1.00
R1634:Mpp7	UTSW	18	7350984	missense	possibly damaging	0.63
R1859:Mpp7	UTSW	18	7350967	makesense	probably null
R2379:Mpp7	UTSW	18	7403345	nonsense	probably null
R2869:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R2871:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3008:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3009:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3010:Mpp7	UTSW	18	7461678	missense	possibly damaging	0.76
R3782:Mpp7	UTSW	18	7351085	missense	probably damaging	0.99
R3980:Mpp7	UTSW	18	7444062	missense	probably benign	0.23
R4574:Mpp7	UTSW	18	7353228	missense	probably benign	0.02
R4772:Mpp7	UTSW	18	7379983	splice site	probably null
R5066:Mpp7	UTSW	18	7513002	missense	possibly damaging	0.95
R5437:Mpp7	UTSW	18	7458930	critical splice donor site	probably null
R5451:Mpp7	UTSW	18	7442855	missense	probably null	0.95
R5578:Mpp7	UTSW	18	7355101	missense	probably benign
R5651:Mpp7	UTSW	18	7355016	critical splice donor site	probably null
R5787:Mpp7	UTSW	18	7461682	missense	probably benign
R6979:Mpp7	UTSW	18	7355049	missense	possibly damaging	0.64
R6984:Mpp7	UTSW	18	7441623	missense	probably damaging	1.00
R7448:Mpp7	UTSW	18	7351079	missense	probably damaging	0.98
R7517:Mpp7	UTSW	18	7440183	nonsense	probably null
R8278:Mpp7	UTSW	18	7444025	missense	probably benign
R8373:Mpp7	UTSW	18	7444096	missense	probably damaging	1.00
R8676:Mpp7	UTSW	18	7440430	critical splice donor site	probably null
R9206:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9208:Mpp7	UTSW	18	7403327	missense	probably benign	0.12
R9439:Mpp7	UTSW	18	7461692	nonsense	probably null
R9790:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
R9791:Mpp7	UTSW	18	7355049	missense	probably benign	0.07
X0028:Mpp7	UTSW	18	7403273	missense	probably benign	0.04
Z1177:Mpp7	UTSW	18	7355062	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACAAGCGTGGTGATGACAG -3'
(R):5'- TGTTCTGTCTGAAGAAAGTTTTGCC -3'

Sequencing Primer
(F):5'- CAGAGATTTGGGAAACATTTGCAAC -3'
(R):5'- GGATTGCATATACATGTCTGCC -3'

Posted On

2015-02-18