Incidental Mutation 'R2869:Cd6'
ID266470
Institutional Source Beutler Lab
Gene Symbol Cd6
Ensembl Gene ENSMUSG00000024670
Gene NameCD6 antigen
Synonyms
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10789341-10830058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10794626 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 307 (I307T)
Ref Sequence ENSEMBL: ENSMUSP00000134639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039043] [ENSMUST00000080292] [ENSMUST00000174176]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000025572
Predicted Effect probably benign
Transcript: ENSMUST00000039043
AA Change: I408T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046861
Gene: ENSMUSG00000024670
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 611 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080292
AA Change: I408T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079172
Gene: ENSMUSG00000024670
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173613
Predicted Effect possibly damaging
Transcript: ENSMUST00000174176
AA Change: I307T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134639
Gene: ENSMUSG00000024670
AA Change: I307T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
low complexity region 282 293 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
Meta Mutation Damage Score 0.4887 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein found on the outer membrane of T-lymphocytes as well as some other immune cells. The encoded protein contains three scavenger receptor cysteine-rich (SRCR) domains and a binding site for an activated leukocyte cell adhesion molecule. The gene product is important for continuation of T cell activation. This gene may be associated with susceptibility to multiple sclerosis (PMID: 19525953, 21849685). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to insteinal ischemia/reperfusion induced injury due to reduced IgM-producing B1a cell self-renewal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Carmil1 G A 13: 24,045,068 silent Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gm26902 T A 19: 34,474,810 H106L probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Habp2 T A 19: 56,287,991 probably benign Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
March8 C T 6: 116,401,145 probably benign Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Cd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Cd6 APN 19 10796394 splice site probably benign
IGL01326:Cd6 APN 19 10791102 missense probably benign 0.09
IGL01406:Cd6 APN 19 10791137 missense possibly damaging 0.77
IGL01885:Cd6 APN 19 10799237 missense probably benign
IGL02268:Cd6 APN 19 10796388 missense probably benign 0.03
IGL03100:Cd6 APN 19 10792939 missense probably benign 0.34
R1856:Cd6 UTSW 19 10798602 missense probably damaging 0.98
R2419:Cd6 UTSW 19 10792852 missense probably damaging 1.00
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2874:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2936:Cd6 UTSW 19 10796322 splice site probably null
R4124:Cd6 UTSW 19 10790608 missense probably damaging 1.00
R4748:Cd6 UTSW 19 10794225 nonsense probably null
R6665:Cd6 UTSW 19 10791003 missense probably benign 0.03
R6720:Cd6 UTSW 19 10794609 missense probably benign 0.09
R7793:Cd6 UTSW 19 10798358 nonsense probably null
Z1177:Cd6 UTSW 19 10791445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGCTGGGAAAATCTTTC -3'
(R):5'- AAGTGGATCAGTTCATGGGTAG -3'

Sequencing Primer
(F):5'- TCCCACCATCAAGAGGTTTGG -3'
(R):5'- TGGATCAGTTCATGGGTAGAAAGTC -3'
Posted On2015-02-18