Incidental Mutation 'R2870:Mtor'
ID 266495
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Name mechanistic target of rapamycin kinase
Synonyms RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission 040458-MU
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394
Essential gene? Essential (E-score: 1.000) question?
Stock # R2870 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 148448611-148557683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 148540030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 2089 (M2089K)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
AlphaFold Q9JLN9
Predicted Effect probably benign
Transcript: ENSMUST00000103221
AA Change: M2089K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: M2089K

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158456
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Brushes UTSW 4 148463748 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 splice site probably null
Erg UTSW 4 148545596 missense probably damaging 1.00
Lindor UTSW 4 148454646 missense probably damaging 1.00
motor UTSW 4 148491360 missense possibly damaging 0.76
R4858_Mtor_211 UTSW 4 148454816 makesense probably null
Vigor UTSW 4 148538899 missense probably damaging 1.00
Vim UTSW 4 148525803 critical splice donor site probably null
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 splice site probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
R7697:Mtor UTSW 4 148540308 nonsense probably null
R7737:Mtor UTSW 4 148538738 missense possibly damaging 0.95
R7791:Mtor UTSW 4 148462940 missense probably benign 0.00
R7858:Mtor UTSW 4 148454646 missense probably damaging 1.00
R8035:Mtor UTSW 4 148546399 missense probably benign 0.29
R8076:Mtor UTSW 4 148525803 critical splice donor site probably null
R8078:Mtor UTSW 4 148468287 missense probably benign
R8928:Mtor UTSW 4 148538899 missense probably damaging 1.00
R9040:Mtor UTSW 4 148463748 missense probably benign 0.00
R9116:Mtor UTSW 4 148552741 missense probably benign
R9284:Mtor UTSW 4 148459080 missense probably benign 0.03
R9310:Mtor UTSW 4 148469377 missense probably benign 0.03
R9374:Mtor UTSW 4 148514940 missense probably damaging 1.00
R9417:Mtor UTSW 4 148538319 nonsense probably null
R9465:Mtor UTSW 4 148540382 missense possibly damaging 0.92
R9492:Mtor UTSW 4 148484344 missense probably damaging 1.00
R9499:Mtor UTSW 4 148514940 missense probably damaging 1.00
R9516:Mtor UTSW 4 148484646 missense probably benign 0.23
R9600:Mtor UTSW 4 148547635 missense possibly damaging 0.82
R9622:Mtor UTSW 4 148483712 missense probably damaging 0.99
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Z1176:Mtor UTSW 4 148550125 missense probably benign 0.08
Z1176:Mtor UTSW 4 148550130 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TAGGCCATCTTCATGCCCTG -3'
(R):5'- CTTAGATTTCTGCCACTCCAAAG -3'

Sequencing Primer
(F):5'- ATCTTCATGCCCTGGGAGC -3'
(R):5'- GTTCTTTCAGTAAATGGCTACAAGC -3'
Posted On 2015-02-18