Incidental Mutation 'R2870:Dmp1'

• ID: 266502
• Institutional Source: Beutler Lab
• Gene Symbol: Dmp1
• Ensembl Gene: ENSMUSG00000029307
• Gene Name: dentin matrix protein 1
• MMRRC Submission: 040458-MU
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R2870 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 5
• Chromosomal Location: 104202613-104214102 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 104212108 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Serine to Glycine at position 217 (S217G)
• Ref Sequence: ENSEMBL: ENSMUSP00000068053
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000066708]
• AlphaFold: O55188
• Predicted Effect: probably benign; Transcript: ENSMUST00000066708; AA Change: S217G; PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
• SMART Domains: Protein: ENSMUSP00000068053; Gene: ENSMUSG00000029307; AA Change: S217G

Domain	Start	End	E-Value	Type
Pfam:DMP1	1	503	9.8e-206	PFAM

• Coding Region Coverage:
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
• Posted On: 2015-02-18

Predicted Primers

PCR Primer
(F):5'- CAGTCCAGTGAAGACAGCAC -3'
(R):5'- TGTAGTCTTCCTCAGAGACGTG -3'

Sequencing Primer
(F):5'- GTCCAGTGAAGACAGCACCTCTC -3'
(R):5'- TCAGAGACGTGGGACCTTCTG -3'