Incidental Mutation 'R2870:Vmn2r68'
ID 266513
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms EG620697, Vmn2r68-ps
MMRRC Submission 040458-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R2870 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 84870726-84886912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84882834 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 306 (M306R)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: M306R

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M306R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A G 3: 30,653,847 (GRCm39) V51A probably damaging Het
Adgb C T 10: 10,307,025 (GRCm39) probably null Het
Als2 A G 1: 59,250,296 (GRCm39) S483P probably damaging Het
Ankrd10 C T 8: 11,665,682 (GRCm39) R306H probably damaging Het
Arhgef10 T C 8: 15,025,093 (GRCm39) probably null Het
Arhgef10 A G 8: 15,025,666 (GRCm39) I459V probably benign Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp12a A G 14: 56,624,407 (GRCm39) R952G possibly damaging Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
C030034I22Rik T A 17: 69,725,106 (GRCm39) noncoding transcript Het
Cacna2d1 G A 5: 16,517,566 (GRCm39) C404Y probably damaging Het
Ccdc163 T C 4: 116,599,058 (GRCm39) silent Het
Ccdc59 A T 10: 105,677,388 (GRCm39) K9M possibly damaging Het
Cd6 A G 19: 10,771,990 (GRCm39) I307T possibly damaging Het
Cimap1d G A 10: 79,481,487 (GRCm39) T14I probably benign Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Csmd3 C T 15: 47,721,320 (GRCm39) G1437D probably damaging Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Dcp1b C T 6: 119,191,735 (GRCm39) S217L probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Dmp1 A G 5: 104,359,974 (GRCm39) S217G probably benign Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eral1 A G 11: 77,967,104 (GRCm39) I164T possibly damaging Het
Esr1 G A 10: 4,947,890 (GRCm39) R481H probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Gbp11 C T 5: 105,478,866 (GRCm39) D191N probably benign Het
Gm21759 T A 5: 8,230,863 (GRCm39) probably benign Het
Gm5454 C A 13: 103,494,031 (GRCm39) noncoding transcript Het
Gm9874 A T 17: 30,704,763 (GRCm39) probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Gria4 T A 9: 4,503,614 (GRCm39) N334I probably damaging Het
Grm5 T C 7: 87,251,930 (GRCm39) V60A possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ino80d C T 1: 63,100,198 (GRCm39) probably null Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Krt31 T G 11: 99,938,699 (GRCm39) N298T possibly damaging Het
Mapk7 C A 11: 61,381,038 (GRCm39) probably benign Het
Marchf8 C T 6: 116,378,106 (GRCm39) probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mdm1 A G 10: 117,986,847 (GRCm39) T267A probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mtm1 T C X: 70,339,968 (GRCm39) probably benign Homo
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Mylk2 A G 2: 152,761,268 (GRCm39) K457R probably damaging Het
Nell1 A T 7: 49,899,405 (GRCm39) probably benign Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Or10g1 T G 14: 52,648,318 (GRCm39) T4P probably benign Het
Or6c211 A T 10: 129,505,628 (GRCm39) C253* probably null Het
Or8k33 T C 2: 86,383,928 (GRCm39) D180G possibly damaging Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Otud4 T A 8: 80,387,702 (GRCm39) N300K possibly damaging Het
Otx1 A G 11: 21,948,681 (GRCm39) probably benign Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Pcdhb20 A T 18: 37,638,833 (GRCm39) Q453L possibly damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Plcl1 A T 1: 55,736,309 (GRCm39) D550V probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Pold1 C T 7: 44,192,771 (GRCm39) silent Het
Ppp1r7 T A 1: 93,285,585 (GRCm39) probably null Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Pzp A T 6: 128,462,519 (GRCm39) probably null Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Retnla A G 16: 48,663,975 (GRCm39) R90G probably benign Het
Semp2l2b A T 10: 21,943,278 (GRCm39) I234N probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Slc5a8 A G 10: 88,740,825 (GRCm39) I247V probably benign Het
Son A G 16: 91,461,205 (GRCm39) probably null Het
Spcs2 T C 7: 99,488,968 (GRCm39) D240G probably damaging Het
Stx3 A T 19: 11,766,938 (GRCm39) V91D probably damaging Het
Taf6l A G 19: 8,755,992 (GRCm39) probably benign Het
Tafa2 A T 10: 123,540,270 (GRCm39) H42L possibly damaging Het
Tbc1d8 A G 1: 39,444,398 (GRCm39) F187S probably damaging Het
Thbs1 C G 2: 117,949,859 (GRCm39) N611K probably damaging Het
Tipin A C 9: 64,211,609 (GRCm39) S232R probably benign Het
Tmem132b A G 5: 125,715,332 (GRCm39) D347G probably benign Het
Tmem161a C T 8: 70,631,565 (GRCm39) probably benign Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Ybx3 G A 6: 131,347,376 (GRCm39) A253V probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Zzz3 T A 3: 152,152,481 (GRCm39) silent Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 84,886,819 (GRCm39) missense probably benign
IGL01477:Vmn2r68 APN 7 84,882,691 (GRCm39) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 84,871,468 (GRCm39) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 84,871,325 (GRCm39) missense probably benign
IGL01999:Vmn2r68 APN 7 84,871,439 (GRCm39) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 84,870,947 (GRCm39) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 84,871,153 (GRCm39) nonsense probably null
IGL02827:Vmn2r68 APN 7 84,886,800 (GRCm39) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 84,882,595 (GRCm39) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 84,883,649 (GRCm39) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 84,871,448 (GRCm39) nonsense probably null
IGL03166:Vmn2r68 APN 7 84,871,331 (GRCm39) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 84,870,972 (GRCm39) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 84,882,963 (GRCm39) missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0281:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0348:Vmn2r68 UTSW 7 84,870,884 (GRCm39) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0722:Vmn2r68 UTSW 7 84,870,794 (GRCm39) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 84,886,712 (GRCm39) splice site probably null
R1136:Vmn2r68 UTSW 7 84,871,549 (GRCm39) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 84,881,700 (GRCm39) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 84,870,946 (GRCm39) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 84,882,574 (GRCm39) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 84,882,886 (GRCm39) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 84,883,867 (GRCm39) nonsense probably null
R1908:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 84,883,102 (GRCm39) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 84,871,123 (GRCm39) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2185:Vmn2r68 UTSW 7 84,882,901 (GRCm39) nonsense probably null
R2188:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2282:Vmn2r68 UTSW 7 84,870,859 (GRCm39) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 84,883,803 (GRCm39) missense probably benign
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 84,886,875 (GRCm39) missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R3978:Vmn2r68 UTSW 7 84,881,670 (GRCm39) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4421:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4478:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4479:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4495:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4628:Vmn2r68 UTSW 7 84,883,673 (GRCm39) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 84,870,743 (GRCm39) missense probably benign
R4654:Vmn2r68 UTSW 7 84,882,769 (GRCm39) nonsense probably null
R4793:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 84,881,622 (GRCm39) missense probably benign
R5021:Vmn2r68 UTSW 7 84,882,942 (GRCm39) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 84,883,076 (GRCm39) missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 84,871,199 (GRCm39) missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 84,871,085 (GRCm39) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 84,886,767 (GRCm39) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 84,882,926 (GRCm39) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 84,871,283 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 84,882,978 (GRCm39) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 84,886,812 (GRCm39) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 84,871,453 (GRCm39) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 84,883,048 (GRCm39) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 84,870,973 (GRCm39) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 84,882,915 (GRCm39) missense probably benign
R6699:Vmn2r68 UTSW 7 84,881,583 (GRCm39) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 84,871,460 (GRCm39) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 84,883,042 (GRCm39) missense probably benign
R7374:Vmn2r68 UTSW 7 84,881,607 (GRCm39) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 84,881,587 (GRCm39) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 84,883,116 (GRCm39) missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 84,883,722 (GRCm39) missense probably benign
R7979:Vmn2r68 UTSW 7 84,883,625 (GRCm39) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 84,871,422 (GRCm39) nonsense probably null
R8349:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 84,871,108 (GRCm39) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 84,886,722 (GRCm39) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 84,871,321 (GRCm39) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 84,871,420 (GRCm39) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 84,882,993 (GRCm39) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 84,882,757 (GRCm39) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 84,871,289 (GRCm39) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 84,870,941 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 84,871,307 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAAGTGGTGTCATGAATAACC -3'
(R):5'- AGCATGGCCCATAAAGAGTTTC -3'

Sequencing Primer
(F):5'- GGTTGGACAATTCTTCAGCTTC -3'
(R):5'- CATGGCCCATAAAGAGTTTCAAAGG -3'
Posted On 2015-02-18