Mutagenetix > Incidental Mutations

Incidental Mutation 'R2870:Arhgef10'

List |< first << previous [record 7 of 81] next >> last >|

266517

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor (GEF) 10

Synonyms

6430549H08Rik

MMRRC Submission

040458-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2870 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14911663-15001085 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 14975093 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]

Predicted Effect

probably null
Transcript: ENSMUST00000084207

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110800

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163062

SMART Domains

Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176

Domain	Start	End	E-Value	Type
RhoGEF	73	255	9.79e-58	SMART
Blast:PH	289	501	2e-47	BLAST
low complexity region	899	915	N/A	INTRINSIC

Meta Mutation Damage Score

0.9484

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	A	T	10: 22,067,379	I234N	probably benign	Het
Actrt3	A	G	3: 30,599,698	V51A	probably damaging	Het
Adgb	C	T	10: 10,431,281		probably null	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Als2	A	G	1: 59,211,137	S483P	probably damaging	Het
Ankrd10	C	T	8: 11,615,682	R306H	probably damaging	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp12a	A	G	14: 56,386,950	R952G	possibly damaging	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
C030034I22Rik	T	A	17: 69,418,111		noncoding transcript	Het
Cacna2d1	G	A	5: 16,312,568	C404Y	probably damaging	Het
Ccdc163	T	C	4: 116,741,861		silent	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Csmd3	C	T	15: 47,857,924	G1437D	probably damaging	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Dcp1b	C	T	6: 119,214,774	S217L	probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Dmp1	A	G	5: 104,212,108	S217G	probably benign	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eral1	A	G	11: 78,076,278	I164T	possibly damaging	Het
Esr1	G	A	10: 4,997,890	R481H	probably damaging	Het
Fam19a2	A	T	10: 123,704,365	H42L	possibly damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Gbp11	C	T	5: 105,331,000	D191N	probably benign	Het
Gm21759	T	A	5: 8,180,863		probably benign	Het
Gm5454	C	A	13: 103,357,523		noncoding transcript	Het
Gm9874	A	T	17: 30,485,789		probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Gria4	T	A	9: 4,503,614	N334I	probably damaging	Het
Grm5	T	C	7: 87,602,722	V60A	possibly damaging	Het
Ift172	C	T	5: 31,257,861	V1335I	probably benign	Het
Ino80d	C	T	1: 63,061,039		probably null	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Krt31	T	G	11: 100,047,873	N298T	possibly damaging	Het
Mapk7	C	A	11: 61,490,212		probably benign	Het
March8	C	T	6: 116,401,145		probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mdm1	A	G	10: 118,150,942	T267A	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mtm1	T	C	X: 71,296,362		probably benign	Homo
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Mylk2	A	G	2: 152,919,348	K457R	probably damaging	Het
Nell1	A	T	7: 50,249,657		probably benign	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Odf3l2	G	A	10: 79,645,653	T14I	probably benign	Het
Olfr1080	T	C	2: 86,553,584	D180G	possibly damaging	Het
Olfr1510	T	G	14: 52,410,861	T4P	probably benign	Het
Olfr801	A	T	10: 129,669,759	C253*	probably null	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Otud4	T	A	8: 79,661,073	N300K	possibly damaging	Het
Otx1	A	G	11: 21,998,681		probably benign	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Pcdhb20	A	T	18: 37,505,780	Q453L	possibly damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Plcl1	A	T	1: 55,697,150	D550V	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Pold1	C	T	7: 44,543,347		silent	Het
Ppp1r7	T	A	1: 93,357,863		probably null	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Pzp	A	T	6: 128,485,556		probably null	Het
Rel	T	C	11: 23,761,129	I13V	probably benign	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Retnla	A	G	16: 48,843,612	R90G	probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Slc5a8	A	G	10: 88,904,963	I247V	probably benign	Het
Son	A	G	16: 91,664,317		probably null	Het
Spcs2	T	C	7: 99,839,761	D240G	probably damaging	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Taf6l	A	G	19: 8,778,628		probably benign	Het
Tbc1d8	A	G	1: 39,405,317	F187S	probably damaging	Het
Thbs1	C	G	2: 118,119,378	N611K	probably damaging	Het
Tipin	A	C	9: 64,304,327	S232R	probably benign	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	C	T	8: 70,178,915		probably benign	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Ybx3	G	A	6: 131,370,413	A253V	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het
Zzz3	T	A	3: 152,446,844		silent	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	14975006	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14940378	unclassified	probably benign
IGL01012:Arhgef10	APN	8	14979977	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	14991054	splice site	probably null
IGL01596:Arhgef10	APN	8	14999468	nonsense	probably null
IGL01888:Arhgef10	APN	8	14962577	nonsense	probably null
IGL01938:Arhgef10	APN	8	14991062	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14928889	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14947205	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	14997551	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	14954819	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	14961238	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	14954505	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14928847	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	14991070	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14940343	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14940225	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	14991211	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14947157	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	14979836	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	14956987	splice site	probably benign
R2051:Arhgef10	UTSW	8	14945320	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	14983898	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2318:Arhgef10	UTSW	8	14928855	missense	probably damaging	1.00
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R3522:Arhgef10	UTSW	8	14954918	missense	probably damaging	1.00
R4049:Arhgef10	UTSW	8	14979998	missense	probably benign	0.05
R4324:Arhgef10	UTSW	8	14940335	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	14991145	nonsense	probably null
R4384:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4385:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4685:Arhgef10	UTSW	8	14956963	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14932408	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14930051	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	14954774	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	14980028	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	14962522	missense	probably damaging	1.00
R6593:Arhgef10	UTSW	8	14962564	missense	possibly damaging	0.82
R6734:Arhgef10	UTSW	8	14975053	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	14975005	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14928786	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	14958639	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	14997547	nonsense	probably null
R7157:Arhgef10	UTSW	8	14930030	missense	probably damaging	1.00
R7232:Arhgef10	UTSW	8	14940323	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	14979854	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	14979893	missense	probably damaging	1.00
R7736:Arhgef10	UTSW	8	14980583	nonsense	probably null
R7777:Arhgef10	UTSW	8	14945373	missense	probably damaging	1.00
X0024:Arhgef10	UTSW	8	14978486	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	14997631	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	14964191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AATGTATTTCGGTGCCGCCC -3'
(R):5'- CTGGGGACTAATCACACAGAGAC -3'

Sequencing Primer
(F):5'- CCAGGCAGGGTACAGTAAGC -3'
(R):5'- GAGACATAAAATCCAAGCTCAAGTG -3'

Posted On

2015-02-18