Incidental Mutation 'R2870:Mdm1'
ID266530
Institutional Source Beutler Lab
Gene Symbol Mdm1
Ensembl Gene ENSMUSG00000020212
Gene Nametransformed mouse 3T3 cell double minute 1
SynonymsArrd2, Mdm-1
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2870 (G1)
Quality Score218
Status Not validated
Chromosome10
Chromosomal Location118141811-118168997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118150942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000132966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020437] [ENSMUST00000163238] [ENSMUST00000164077] [ENSMUST00000169817] [ENSMUST00000219087]
Predicted Effect probably benign
Transcript: ENSMUST00000020437
AA Change: T267A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020437
Gene: ENSMUSG00000020212
AA Change: T267A

DomainStartEndE-ValueType
Pfam:MDM1 9 544 1.1e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163238
AA Change: T267A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127919
Gene: ENSMUSG00000020212
AA Change: T267A

DomainStartEndE-ValueType
Pfam:MDM1 9 554 1.3e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164077
AA Change: T267A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132966
Gene: ENSMUSG00000020212
AA Change: T267A

DomainStartEndE-ValueType
Pfam:MDM1 9 544 5.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169817
AA Change: T222A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126258
Gene: ENSMUSG00000020212
AA Change: T222A

DomainStartEndE-ValueType
Pfam:MDM1 9 172 8.3e-55 PFAM
Pfam:MDM1 168 509 1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218400
Predicted Effect probably benign
Transcript: ENSMUST00000219087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219827
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein similar to the mouse double minute 1 protein. The mouse gene is located in double minute (DM) chromatin particles, is amplified in the mouse transformed 3T3 cell line, and the encoded protein is able to bind to p53. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a nonsense point mutation exhibit retinal degeneration, abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Mdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Mdm1 APN 10 118164441 missense probably damaging 1.00
IGL01400:Mdm1 APN 10 118157251 missense probably damaging 1.00
IGL01504:Mdm1 APN 10 118146600 missense probably damaging 1.00
IGL02070:Mdm1 APN 10 118146618 missense probably damaging 1.00
IGL02149:Mdm1 APN 10 118148065 missense probably damaging 1.00
IGL02817:Mdm1 APN 10 118164346 missense possibly damaging 0.66
IGL03076:Mdm1 APN 10 118159683 missense possibly damaging 0.95
PIT4696001:Mdm1 UTSW 10 118158540 missense probably benign
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0166:Mdm1 UTSW 10 118166680 missense probably damaging 0.96
R0218:Mdm1 UTSW 10 118156878 splice site probably benign
R0446:Mdm1 UTSW 10 118152056 missense probably benign 0.01
R0605:Mdm1 UTSW 10 118146601 missense probably damaging 1.00
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2873:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R4816:Mdm1 UTSW 10 118146877 missense possibly damaging 0.82
R5571:Mdm1 UTSW 10 118159683 missense possibly damaging 0.95
R5623:Mdm1 UTSW 10 118150789 missense possibly damaging 0.66
R5806:Mdm1 UTSW 10 118166658 missense probably benign
R6537:Mdm1 UTSW 10 118158576 missense probably benign 0.00
R6539:Mdm1 UTSW 10 118150958 critical splice donor site probably null
R6891:Mdm1 UTSW 10 118148032 missense probably benign 0.04
R6952:Mdm1 UTSW 10 118168057 missense probably damaging 1.00
R7176:Mdm1 UTSW 10 118142865 missense probably damaging 1.00
R7346:Mdm1 UTSW 10 118164288 nonsense probably null
R7442:Mdm1 UTSW 10 118146685 missense probably benign 0.16
R7464:Mdm1 UTSW 10 118152266 missense probably benign 0.00
Z1088:Mdm1 UTSW 10 118158362 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACACCTAAGTTCTGTACCACTTAG -3'
(R):5'- TCCTCTCAGTCTACACAGGAC -3'

Sequencing Primer
(F):5'- GTTCTGTACCACTTAGTAACCAAC -3'
(R):5'- AGGACCTGACTCCACGGAAG -3'
Posted On2015-02-18