Incidental Mutation 'R2870:Csmd3'
ID 266542
Institutional Source Beutler Lab
Gene Symbol Csmd3
Ensembl Gene ENSMUSG00000022311
Gene Name CUB and Sushi multiple domains 3
Synonyms 4930500N14Rik
MMRRC Submission 040458-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2870 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 47444033-48655459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 47721320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1437 (G1437D)
Ref Sequence ENSEMBL: ENSMUSP00000124753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000162830]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000100670
AA Change: G1541D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311
AA Change: G1541D

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160658
AA Change: G1437D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311
AA Change: G1437D

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161653
AA Change: G700D
SMART Domains Protein: ENSMUSP00000124195
Gene: ENSMUSG00000022311
AA Change: G700D

DomainStartEndE-ValueType
CCP 1 51 6.59e-1 SMART
CUB 55 163 3.23e-37 SMART
CCP 170 223 1.82e-13 SMART
CUB 227 337 4.87e-23 SMART
CCP 342 397 1.82e-13 SMART
CUB 401 509 5.02e-25 SMART
CCP 514 570 2.5e-11 SMART
CUB 574 683 6.27e-26 SMART
CCP 688 744 4.41e-12 SMART
CUB 748 856 5.37e-34 SMART
CCP 861 918 1.18e-12 SMART
Pfam:CUB 922 964 9.7e-8 PFAM
CCP 968 1025 1.84e-9 SMART
CUB 1029 1137 1.8e-35 SMART
CCP 1142 1197 4.48e-13 SMART
CUB 1201 1309 3.95e-32 SMART
CCP 1314 1369 4.02e-15 SMART
CUB 1373 1480 1.74e-33 SMART
CCP 1485 1542 5.82e-12 SMART
CUB 1547 1657 5.3e-24 SMART
CCP 1659 1717 2.11e-9 SMART
CCP 1722 1779 8.23e-12 SMART
CCP 1784 1844 8.56e-10 SMART
CCP 1849 1902 1.14e-14 SMART
CCP 1907 1960 4.76e-17 SMART
CCP 1965 2018 1.85e-14 SMART
CCP 2023 2080 9.9e-15 SMART
CCP 2085 2138 1.79e-12 SMART
CCP 2146 2199 1.72e-14 SMART
CCP 2204 2258 3.17e-13 SMART
CCP 2263 2318 1.25e-11 SMART
CCP 2323 2376 1.25e-11 SMART
CCP 2381 2434 8.23e-12 SMART
CCP 2442 2496 5.6e-14 SMART
CCP 2501 2556 1.89e-11 SMART
transmembrane domain 2720 2742 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162830
AA Change: G1541D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311
AA Change: G1541D

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A G 3: 30,653,847 (GRCm39) V51A probably damaging Het
Adgb C T 10: 10,307,025 (GRCm39) probably null Het
Als2 A G 1: 59,250,296 (GRCm39) S483P probably damaging Het
Ankrd10 C T 8: 11,665,682 (GRCm39) R306H probably damaging Het
Arhgef10 T C 8: 15,025,093 (GRCm39) probably null Het
Arhgef10 A G 8: 15,025,666 (GRCm39) I459V probably benign Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp12a A G 14: 56,624,407 (GRCm39) R952G possibly damaging Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
C030034I22Rik T A 17: 69,725,106 (GRCm39) noncoding transcript Het
Cacna2d1 G A 5: 16,517,566 (GRCm39) C404Y probably damaging Het
Ccdc163 T C 4: 116,599,058 (GRCm39) silent Het
Ccdc59 A T 10: 105,677,388 (GRCm39) K9M possibly damaging Het
Cd6 A G 19: 10,771,990 (GRCm39) I307T possibly damaging Het
Cimap1d G A 10: 79,481,487 (GRCm39) T14I probably benign Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Dcp1b C T 6: 119,191,735 (GRCm39) S217L probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Dmp1 A G 5: 104,359,974 (GRCm39) S217G probably benign Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eral1 A G 11: 77,967,104 (GRCm39) I164T possibly damaging Het
Esr1 G A 10: 4,947,890 (GRCm39) R481H probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Gbp11 C T 5: 105,478,866 (GRCm39) D191N probably benign Het
Gm21759 T A 5: 8,230,863 (GRCm39) probably benign Het
Gm5454 C A 13: 103,494,031 (GRCm39) noncoding transcript Het
Gm9874 A T 17: 30,704,763 (GRCm39) probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Gria4 T A 9: 4,503,614 (GRCm39) N334I probably damaging Het
Grm5 T C 7: 87,251,930 (GRCm39) V60A possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ino80d C T 1: 63,100,198 (GRCm39) probably null Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Krt31 T G 11: 99,938,699 (GRCm39) N298T possibly damaging Het
Mapk7 C A 11: 61,381,038 (GRCm39) probably benign Het
Marchf8 C T 6: 116,378,106 (GRCm39) probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mdm1 A G 10: 117,986,847 (GRCm39) T267A probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mtm1 T C X: 70,339,968 (GRCm39) probably benign Homo
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Mylk2 A G 2: 152,761,268 (GRCm39) K457R probably damaging Het
Nell1 A T 7: 49,899,405 (GRCm39) probably benign Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Or10g1 T G 14: 52,648,318 (GRCm39) T4P probably benign Het
Or6c211 A T 10: 129,505,628 (GRCm39) C253* probably null Het
Or8k33 T C 2: 86,383,928 (GRCm39) D180G possibly damaging Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Otud4 T A 8: 80,387,702 (GRCm39) N300K possibly damaging Het
Otx1 A G 11: 21,948,681 (GRCm39) probably benign Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Pcdhb20 A T 18: 37,638,833 (GRCm39) Q453L possibly damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Plcl1 A T 1: 55,736,309 (GRCm39) D550V probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Pold1 C T 7: 44,192,771 (GRCm39) silent Het
Ppp1r7 T A 1: 93,285,585 (GRCm39) probably null Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Pzp A T 6: 128,462,519 (GRCm39) probably null Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Retnla A G 16: 48,663,975 (GRCm39) R90G probably benign Het
Semp2l2b A T 10: 21,943,278 (GRCm39) I234N probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Slc5a8 A G 10: 88,740,825 (GRCm39) I247V probably benign Het
Son A G 16: 91,461,205 (GRCm39) probably null Het
Spcs2 T C 7: 99,488,968 (GRCm39) D240G probably damaging Het
Stx3 A T 19: 11,766,938 (GRCm39) V91D probably damaging Het
Taf6l A G 19: 8,755,992 (GRCm39) probably benign Het
Tafa2 A T 10: 123,540,270 (GRCm39) H42L possibly damaging Het
Tbc1d8 A G 1: 39,444,398 (GRCm39) F187S probably damaging Het
Thbs1 C G 2: 117,949,859 (GRCm39) N611K probably damaging Het
Tipin A C 9: 64,211,609 (GRCm39) S232R probably benign Het
Tmem132b A G 5: 125,715,332 (GRCm39) D347G probably benign Het
Tmem161a C T 8: 70,631,565 (GRCm39) probably benign Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Ybx3 G A 6: 131,347,376 (GRCm39) A253V probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Zzz3 T A 3: 152,152,481 (GRCm39) silent Het
Other mutations in Csmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Csmd3 APN 15 48,150,891 (GRCm39) missense possibly damaging 0.61
IGL00591:Csmd3 APN 15 47,868,279 (GRCm39) missense probably damaging 1.00
IGL00668:Csmd3 APN 15 47,777,341 (GRCm39) missense probably damaging 1.00
IGL00753:Csmd3 APN 15 47,507,631 (GRCm39) missense probably damaging 1.00
IGL00773:Csmd3 APN 15 47,454,115 (GRCm39) missense probably damaging 0.96
IGL00926:Csmd3 APN 15 47,574,360 (GRCm39) missense possibly damaging 0.87
IGL00942:Csmd3 APN 15 47,710,502 (GRCm39) critical splice donor site probably null
IGL01080:Csmd3 APN 15 47,744,799 (GRCm39) missense probably benign 0.12
IGL01314:Csmd3 APN 15 47,713,151 (GRCm39) missense probably damaging 1.00
IGL01326:Csmd3 APN 15 47,713,181 (GRCm39) missense probably benign 0.06
IGL01393:Csmd3 APN 15 48,320,995 (GRCm39) missense possibly damaging 0.88
IGL01432:Csmd3 APN 15 47,596,895 (GRCm39) missense probably damaging 1.00
IGL01519:Csmd3 APN 15 47,460,246 (GRCm39) missense probably benign 0.31
IGL01530:Csmd3 APN 15 47,533,013 (GRCm39) missense probably damaging 1.00
IGL01530:Csmd3 APN 15 47,701,833 (GRCm39) missense possibly damaging 0.95
IGL01547:Csmd3 APN 15 47,747,013 (GRCm39) missense probably benign 0.41
IGL01594:Csmd3 APN 15 47,492,635 (GRCm39) missense probably benign 0.01
IGL01618:Csmd3 APN 15 47,874,479 (GRCm39) missense probably benign 0.05
IGL01670:Csmd3 APN 15 47,475,225 (GRCm39) missense probably damaging 1.00
IGL01680:Csmd3 APN 15 47,833,426 (GRCm39) missense probably damaging 1.00
IGL01734:Csmd3 APN 15 48,048,700 (GRCm39) missense probably damaging 1.00
IGL01777:Csmd3 APN 15 47,561,594 (GRCm39) missense probably benign 0.06
IGL01779:Csmd3 APN 15 47,721,290 (GRCm39) missense probably benign 0.10
IGL01820:Csmd3 APN 15 47,470,538 (GRCm39) nonsense probably null
IGL01843:Csmd3 APN 15 47,522,395 (GRCm39) splice site probably benign
IGL01919:Csmd3 APN 15 47,539,168 (GRCm39) missense possibly damaging 0.62
IGL01986:Csmd3 APN 15 47,522,591 (GRCm39) missense possibly damaging 0.82
IGL02049:Csmd3 APN 15 47,864,870 (GRCm39) missense possibly damaging 0.91
IGL02065:Csmd3 APN 15 47,530,024 (GRCm39) missense probably damaging 1.00
IGL02112:Csmd3 APN 15 48,177,265 (GRCm39) missense possibly damaging 0.95
IGL02133:Csmd3 APN 15 47,721,338 (GRCm39) missense possibly damaging 0.86
IGL02203:Csmd3 APN 15 47,713,073 (GRCm39) splice site probably null
IGL02215:Csmd3 APN 15 47,449,084 (GRCm39) missense probably damaging 1.00
IGL02234:Csmd3 APN 15 47,811,512 (GRCm39) missense probably damaging 1.00
IGL02326:Csmd3 APN 15 47,619,359 (GRCm39) splice site probably benign
IGL02478:Csmd3 APN 15 47,701,794 (GRCm39) splice site probably benign
IGL02491:Csmd3 APN 15 47,777,511 (GRCm39) splice site probably benign
IGL02598:Csmd3 APN 15 47,533,086 (GRCm39) missense probably damaging 0.98
IGL02626:Csmd3 APN 15 47,567,503 (GRCm39) splice site probably benign
IGL02696:Csmd3 APN 15 47,533,065 (GRCm39) missense probably benign 0.33
IGL02876:Csmd3 APN 15 47,469,492 (GRCm39) splice site probably benign
IGL02971:Csmd3 APN 15 47,777,325 (GRCm39) splice site probably benign
IGL03068:Csmd3 APN 15 47,710,517 (GRCm39) missense possibly damaging 0.69
IGL03087:Csmd3 APN 15 47,840,429 (GRCm39) missense probably damaging 1.00
IGL03114:Csmd3 APN 15 47,683,847 (GRCm39) missense probably damaging 0.99
IGL03146:Csmd3 APN 15 47,744,873 (GRCm39) missense probably benign 0.25
IGL03193:Csmd3 APN 15 47,492,626 (GRCm39) splice site probably benign
IGL03274:Csmd3 APN 15 47,508,900 (GRCm39) missense probably damaging 1.00
R0040:Csmd3 UTSW 15 47,497,212 (GRCm39) missense probably damaging 1.00
R0071:Csmd3 UTSW 15 47,460,217 (GRCm39) missense probably benign 0.04
R0071:Csmd3 UTSW 15 47,460,217 (GRCm39) missense probably benign 0.04
R0119:Csmd3 UTSW 15 47,710,527 (GRCm39) missense probably benign 0.08
R0124:Csmd3 UTSW 15 47,454,112 (GRCm39) missense probably damaging 1.00
R0127:Csmd3 UTSW 15 47,845,326 (GRCm39) missense probably benign 0.45
R0136:Csmd3 UTSW 15 47,710,527 (GRCm39) missense probably benign 0.08
R0201:Csmd3 UTSW 15 47,483,125 (GRCm39) splice site probably benign
R0240:Csmd3 UTSW 15 47,492,635 (GRCm39) missense probably benign 0.05
R0240:Csmd3 UTSW 15 47,492,635 (GRCm39) missense probably benign 0.05
R0318:Csmd3 UTSW 15 47,522,549 (GRCm39) missense probably damaging 1.00
R0369:Csmd3 UTSW 15 47,833,543 (GRCm39) missense probably damaging 1.00
R0391:Csmd3 UTSW 15 47,520,969 (GRCm39) missense probably damaging 1.00
R0499:Csmd3 UTSW 15 47,710,527 (GRCm39) missense probably benign 0.08
R0506:Csmd3 UTSW 15 48,320,907 (GRCm39) missense probably benign 0.00
R0606:Csmd3 UTSW 15 48,321,058 (GRCm39) missense probably benign
R0639:Csmd3 UTSW 15 47,777,336 (GRCm39) missense probably damaging 1.00
R0658:Csmd3 UTSW 15 47,874,543 (GRCm39) missense possibly damaging 0.66
R0673:Csmd3 UTSW 15 47,777,336 (GRCm39) missense probably damaging 1.00
R0689:Csmd3 UTSW 15 47,619,421 (GRCm39) missense probably benign 0.19
R0696:Csmd3 UTSW 15 47,710,569 (GRCm39) missense probably benign 0.01
R0799:Csmd3 UTSW 15 48,048,780 (GRCm39) splice site probably benign
R0834:Csmd3 UTSW 15 47,747,073 (GRCm39) intron probably benign
R0894:Csmd3 UTSW 15 47,721,316 (GRCm39) missense possibly damaging 0.95
R0926:Csmd3 UTSW 15 47,840,429 (GRCm39) missense probably damaging 1.00
R0943:Csmd3 UTSW 15 47,539,135 (GRCm39) missense probably damaging 0.99
R0944:Csmd3 UTSW 15 47,475,227 (GRCm39) missense probably damaging 1.00
R0967:Csmd3 UTSW 15 47,721,227 (GRCm39) missense probably null 0.89
R0973:Csmd3 UTSW 15 47,522,485 (GRCm39) missense probably damaging 1.00
R1055:Csmd3 UTSW 15 47,744,933 (GRCm39) missense probably damaging 1.00
R1066:Csmd3 UTSW 15 47,777,361 (GRCm39) missense probably damaging 1.00
R1086:Csmd3 UTSW 15 47,559,151 (GRCm39) missense probably damaging 0.99
R1103:Csmd3 UTSW 15 47,811,402 (GRCm39) missense probably damaging 1.00
R1136:Csmd3 UTSW 15 47,539,213 (GRCm39) missense probably damaging 1.00
R1139:Csmd3 UTSW 15 47,559,232 (GRCm39) missense probably damaging 1.00
R1158:Csmd3 UTSW 15 48,156,170 (GRCm39) splice site probably null
R1215:Csmd3 UTSW 15 47,868,227 (GRCm39) splice site probably null
R1233:Csmd3 UTSW 15 48,536,927 (GRCm39) missense probably damaging 1.00
R1271:Csmd3 UTSW 15 47,874,455 (GRCm39) missense probably benign 0.11
R1469:Csmd3 UTSW 15 47,532,598 (GRCm39) nonsense probably null
R1469:Csmd3 UTSW 15 47,532,598 (GRCm39) nonsense probably null
R1479:Csmd3 UTSW 15 47,721,282 (GRCm39) missense probably damaging 1.00
R1480:Csmd3 UTSW 15 47,595,325 (GRCm39) missense possibly damaging 0.90
R1526:Csmd3 UTSW 15 47,449,028 (GRCm39) critical splice donor site probably null
R1527:Csmd3 UTSW 15 47,811,483 (GRCm39) missense probably benign 0.08
R1539:Csmd3 UTSW 15 47,683,794 (GRCm39) missense probably benign 0.24
R1544:Csmd3 UTSW 15 47,475,294 (GRCm39) splice site probably null
R1548:Csmd3 UTSW 15 47,845,371 (GRCm39) missense possibly damaging 0.91
R1574:Csmd3 UTSW 15 47,559,257 (GRCm39) splice site probably null
R1574:Csmd3 UTSW 15 47,559,257 (GRCm39) splice site probably null
R1619:Csmd3 UTSW 15 47,813,346 (GRCm39) missense probably damaging 1.00
R1630:Csmd3 UTSW 15 47,701,918 (GRCm39) missense possibly damaging 0.66
R1665:Csmd3 UTSW 15 47,560,185 (GRCm39) missense probably damaging 1.00
R1680:Csmd3 UTSW 15 47,604,566 (GRCm39) missense probably damaging 1.00
R1725:Csmd3 UTSW 15 47,460,203 (GRCm39) missense probably damaging 1.00
R1743:Csmd3 UTSW 15 48,485,485 (GRCm39) missense probably damaging 1.00
R1749:Csmd3 UTSW 15 47,449,056 (GRCm39) missense probably damaging 1.00
R1752:Csmd3 UTSW 15 47,523,669 (GRCm39) missense probably benign 0.15
R1769:Csmd3 UTSW 15 47,567,505 (GRCm39) splice site probably benign
R1775:Csmd3 UTSW 15 47,763,135 (GRCm39) missense probably damaging 0.99
R1795:Csmd3 UTSW 15 47,721,316 (GRCm39) missense possibly damaging 0.95
R1819:Csmd3 UTSW 15 47,617,131 (GRCm39) missense possibly damaging 0.56
R1840:Csmd3 UTSW 15 47,470,560 (GRCm39) missense probably damaging 1.00
R1860:Csmd3 UTSW 15 47,522,588 (GRCm39) missense probably damaging 1.00
R1861:Csmd3 UTSW 15 47,522,588 (GRCm39) missense probably damaging 1.00
R1879:Csmd3 UTSW 15 47,520,915 (GRCm39) missense possibly damaging 0.90
R1958:Csmd3 UTSW 15 47,868,035 (GRCm39) critical splice donor site probably null
R1965:Csmd3 UTSW 15 47,713,144 (GRCm39) missense probably benign 0.15
R1970:Csmd3 UTSW 15 48,536,927 (GRCm39) missense probably damaging 1.00
R2029:Csmd3 UTSW 15 47,701,975 (GRCm39) missense probably damaging 1.00
R2051:Csmd3 UTSW 15 48,485,389 (GRCm39) critical splice donor site probably null
R2108:Csmd3 UTSW 15 47,868,257 (GRCm39) missense possibly damaging 0.81
R2132:Csmd3 UTSW 15 48,320,899 (GRCm39) missense probably benign 0.06
R2146:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2147:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2148:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2157:Csmd3 UTSW 15 47,559,183 (GRCm39) missense probably damaging 0.99
R2159:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2160:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2161:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2162:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2164:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2213:Csmd3 UTSW 15 47,683,843 (GRCm39) missense possibly damaging 0.92
R2301:Csmd3 UTSW 15 47,595,394 (GRCm39) missense probably damaging 1.00
R2302:Csmd3 UTSW 15 48,177,447 (GRCm39) missense probably benign
R2355:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2497:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2509:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2566:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2567:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2568:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2570:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2571:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2870:Csmd3 UTSW 15 47,721,320 (GRCm39) missense probably damaging 1.00
R2907:Csmd3 UTSW 15 47,874,449 (GRCm39) missense probably damaging 0.99
R3116:Csmd3 UTSW 15 47,520,995 (GRCm39) missense probably damaging 1.00
R3423:Csmd3 UTSW 15 47,710,648 (GRCm39) missense probably damaging 0.98
R3425:Csmd3 UTSW 15 47,710,648 (GRCm39) missense probably damaging 0.98
R3508:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R3746:Csmd3 UTSW 15 47,713,162 (GRCm39) missense probably benign 0.04
R3813:Csmd3 UTSW 15 48,655,209 (GRCm39) missense possibly damaging 0.82
R3832:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R3959:Csmd3 UTSW 15 47,507,585 (GRCm39) missense probably benign 0.18
R4042:Csmd3 UTSW 15 47,477,480 (GRCm39) missense probably damaging 1.00
R4043:Csmd3 UTSW 15 47,619,362 (GRCm39) critical splice donor site probably null
R4191:Csmd3 UTSW 15 47,710,667 (GRCm39) missense probably damaging 0.99
R4192:Csmd3 UTSW 15 47,710,667 (GRCm39) missense probably damaging 0.99
R4419:Csmd3 UTSW 15 47,567,707 (GRCm39) missense probably damaging 1.00
R4426:Csmd3 UTSW 15 47,532,581 (GRCm39) missense possibly damaging 0.51
R4434:Csmd3 UTSW 15 47,763,191 (GRCm39) missense possibly damaging 0.68
R4438:Csmd3 UTSW 15 47,763,191 (GRCm39) missense possibly damaging 0.68
R4490:Csmd3 UTSW 15 48,177,429 (GRCm39) missense possibly damaging 0.83
R4562:Csmd3 UTSW 15 47,763,240 (GRCm39) missense probably benign 0.32
R4604:Csmd3 UTSW 15 47,868,211 (GRCm39) missense possibly damaging 0.90
R4620:Csmd3 UTSW 15 47,449,149 (GRCm39) missense probably benign 0.09
R4632:Csmd3 UTSW 15 47,874,605 (GRCm39) missense probably damaging 0.99
R4679:Csmd3 UTSW 15 48,024,479 (GRCm39) nonsense probably null
R4696:Csmd3 UTSW 15 47,777,364 (GRCm39) missense probably benign 0.24
R4718:Csmd3 UTSW 15 47,561,546 (GRCm39) nonsense probably null
R4723:Csmd3 UTSW 15 47,532,556 (GRCm39) missense probably benign 0.29
R4801:Csmd3 UTSW 15 47,484,688 (GRCm39) missense probably damaging 1.00
R4802:Csmd3 UTSW 15 47,484,688 (GRCm39) missense probably damaging 1.00
R4806:Csmd3 UTSW 15 48,177,464 (GRCm39) missense probably benign
R4816:Csmd3 UTSW 15 47,721,330 (GRCm39) missense possibly damaging 0.68
R4935:Csmd3 UTSW 15 48,024,480 (GRCm39) missense probably damaging 1.00
R4955:Csmd3 UTSW 15 48,536,914 (GRCm39) missense probably damaging 0.99
R4991:Csmd3 UTSW 15 47,864,874 (GRCm39) missense probably damaging 1.00
R5031:Csmd3 UTSW 15 47,522,588 (GRCm39) missense probably damaging 1.00
R5034:Csmd3 UTSW 15 47,492,683 (GRCm39) missense possibly damaging 0.94
R5035:Csmd3 UTSW 15 47,454,175 (GRCm39) missense probably damaging 1.00
R5120:Csmd3 UTSW 15 48,536,891 (GRCm39) nonsense probably null
R5224:Csmd3 UTSW 15 47,752,080 (GRCm39) missense possibly damaging 0.91
R5235:Csmd3 UTSW 15 47,492,674 (GRCm39) missense probably benign 0.20
R5279:Csmd3 UTSW 15 48,655,340 (GRCm39) splice site probably null
R5360:Csmd3 UTSW 15 47,532,599 (GRCm39) missense probably damaging 0.99
R5365:Csmd3 UTSW 15 47,868,145 (GRCm39) missense possibly damaging 0.68
R5379:Csmd3 UTSW 15 47,499,846 (GRCm39) nonsense probably null
R5381:Csmd3 UTSW 15 47,604,611 (GRCm39) missense probably benign 0.21
R5393:Csmd3 UTSW 15 47,497,099 (GRCm39) missense probably damaging 1.00
R5413:Csmd3 UTSW 15 47,701,831 (GRCm39) missense probably damaging 1.00
R5549:Csmd3 UTSW 15 48,048,753 (GRCm39) missense probably damaging 0.98
R5550:Csmd3 UTSW 15 48,048,753 (GRCm39) missense probably damaging 0.98
R5551:Csmd3 UTSW 15 48,177,492 (GRCm39) missense probably benign 0.13
R5567:Csmd3 UTSW 15 47,508,864 (GRCm39) missense possibly damaging 0.92
R5621:Csmd3 UTSW 15 48,177,374 (GRCm39) missense possibly damaging 0.84
R5668:Csmd3 UTSW 15 47,559,151 (GRCm39) missense possibly damaging 0.48
R5677:Csmd3 UTSW 15 48,485,447 (GRCm39) missense probably damaging 0.98
R5701:Csmd3 UTSW 15 48,403,729 (GRCm39) missense probably damaging 0.99
R5701:Csmd3 UTSW 15 47,513,617 (GRCm39) missense probably damaging 1.00
R5871:Csmd3 UTSW 15 47,752,112 (GRCm39) missense probably damaging 0.98
R5872:Csmd3 UTSW 15 47,445,923 (GRCm39) missense probably damaging 1.00
R5874:Csmd3 UTSW 15 47,507,666 (GRCm39) missense probably damaging 1.00
R5952:Csmd3 UTSW 15 47,596,901 (GRCm39) missense probably damaging 0.98
R5956:Csmd3 UTSW 15 48,655,278 (GRCm39) missense possibly damaging 0.84
R5966:Csmd3 UTSW 15 47,713,135 (GRCm39) missense probably damaging 0.96
R5969:Csmd3 UTSW 15 47,811,386 (GRCm39) missense probably damaging 1.00
R5989:Csmd3 UTSW 15 47,454,160 (GRCm39) missense possibly damaging 0.69
R6017:Csmd3 UTSW 15 48,177,408 (GRCm39) missense possibly damaging 0.95
R6057:Csmd3 UTSW 15 47,618,787 (GRCm39) missense probably damaging 1.00
R6127:Csmd3 UTSW 15 47,513,624 (GRCm39) missense probably damaging 1.00
R6178:Csmd3 UTSW 15 48,536,854 (GRCm39) missense probably damaging 1.00
R6198:Csmd3 UTSW 15 48,177,273 (GRCm39) missense probably benign 0.28
R6213:Csmd3 UTSW 15 47,492,656 (GRCm39) missense probably damaging 1.00
R6256:Csmd3 UTSW 15 47,533,125 (GRCm39) missense probably damaging 1.00
R6274:Csmd3 UTSW 15 47,484,833 (GRCm39) missense probably benign
R6327:Csmd3 UTSW 15 47,744,783 (GRCm39) missense probably damaging 1.00
R6354:Csmd3 UTSW 15 47,744,885 (GRCm39) missense probably damaging 1.00
R6405:Csmd3 UTSW 15 47,683,767 (GRCm39) missense probably damaging 0.99
R6410:Csmd3 UTSW 15 48,536,803 (GRCm39) missense probably damaging 1.00
R6416:Csmd3 UTSW 15 48,536,956 (GRCm39) missense probably damaging 1.00
R6463:Csmd3 UTSW 15 47,539,875 (GRCm39) missense probably damaging 1.00
R6536:Csmd3 UTSW 15 47,701,863 (GRCm39) missense probably damaging 1.00
R6625:Csmd3 UTSW 15 47,470,471 (GRCm39) missense probably benign 0.02
R6695:Csmd3 UTSW 15 47,721,230 (GRCm39) missense probably damaging 0.99
R6895:Csmd3 UTSW 15 47,529,910 (GRCm39) splice site probably null
R6906:Csmd3 UTSW 15 47,710,569 (GRCm39) missense probably benign 0.01
R6914:Csmd3 UTSW 15 47,874,534 (GRCm39) missense possibly damaging 0.53
R6920:Csmd3 UTSW 15 47,507,601 (GRCm39) missense probably damaging 1.00
R7024:Csmd3 UTSW 15 47,574,387 (GRCm39) missense probably damaging 1.00
R7178:Csmd3 UTSW 15 47,454,170 (GRCm39) missense
R7192:Csmd3 UTSW 15 47,567,633 (GRCm39) missense
R7220:Csmd3 UTSW 15 48,320,994 (GRCm39) missense probably damaging 0.99
R7362:Csmd3 UTSW 15 47,619,388 (GRCm39) missense possibly damaging 0.65
R7380:Csmd3 UTSW 15 47,450,361 (GRCm39) missense
R7397:Csmd3 UTSW 15 47,559,130 (GRCm39) missense
R7467:Csmd3 UTSW 15 47,492,640 (GRCm39) missense
R7585:Csmd3 UTSW 15 48,485,471 (GRCm39) missense possibly damaging 0.76
R7623:Csmd3 UTSW 15 47,813,334 (GRCm39) missense
R7649:Csmd3 UTSW 15 47,532,539 (GRCm39) missense
R7691:Csmd3 UTSW 15 47,604,569 (GRCm39) missense
R7695:Csmd3 UTSW 15 47,683,777 (GRCm39) missense
R7759:Csmd3 UTSW 15 47,561,569 (GRCm39) missense
R7817:Csmd3 UTSW 15 47,721,356 (GRCm39) missense probably damaging 0.99
R8052:Csmd3 UTSW 15 47,569,783 (GRCm39) missense
R8089:Csmd3 UTSW 15 47,532,603 (GRCm39) missense
R8110:Csmd3 UTSW 15 47,507,666 (GRCm39) missense probably damaging 1.00
R8152:Csmd3 UTSW 15 47,532,860 (GRCm39) splice site probably null
R8323:Csmd3 UTSW 15 47,561,547 (GRCm39) missense
R8341:Csmd3 UTSW 15 47,561,547 (GRCm39) missense
R8353:Csmd3 UTSW 15 47,813,349 (GRCm39) missense probably damaging 1.00
R8364:Csmd3 UTSW 15 48,536,837 (GRCm39) missense probably damaging 1.00
R8405:Csmd3 UTSW 15 47,619,379 (GRCm39) missense probably damaging 1.00
R8412:Csmd3 UTSW 15 47,499,794 (GRCm39) missense
R8436:Csmd3 UTSW 15 47,868,218 (GRCm39) missense probably damaging 0.97
R8516:Csmd3 UTSW 15 47,492,761 (GRCm39) nonsense probably null
R8553:Csmd3 UTSW 15 47,484,724 (GRCm39) missense possibly damaging 0.52
R8554:Csmd3 UTSW 15 47,507,538 (GRCm39) missense probably benign 0.32
R8678:Csmd3 UTSW 15 47,499,849 (GRCm39) missense
R8751:Csmd3 UTSW 15 47,845,402 (GRCm39) missense
R8758:Csmd3 UTSW 15 47,469,593 (GRCm39) missense
R8768:Csmd3 UTSW 15 47,561,572 (GRCm39) missense
R8785:Csmd3 UTSW 15 48,177,482 (GRCm39) missense probably benign 0.00
R8788:Csmd3 UTSW 15 47,470,513 (GRCm39) missense
R8798:Csmd3 UTSW 15 47,595,382 (GRCm39) missense
R8801:Csmd3 UTSW 15 48,321,024 (GRCm39) missense possibly damaging 0.70
R8811:Csmd3 UTSW 15 47,560,139 (GRCm39) missense
R8844:Csmd3 UTSW 15 48,536,815 (GRCm39) missense probably damaging 0.98
R8844:Csmd3 UTSW 15 47,604,590 (GRCm39) missense probably damaging 0.96
R8892:Csmd3 UTSW 15 47,604,634 (GRCm39) missense
R8897:Csmd3 UTSW 15 48,222,739 (GRCm39) missense probably benign 0.06
R9001:Csmd3 UTSW 15 47,596,901 (GRCm39) missense
R9007:Csmd3 UTSW 15 47,751,892 (GRCm39) intron probably benign
R9016:Csmd3 UTSW 15 47,522,438 (GRCm39) missense
R9039:Csmd3 UTSW 15 47,483,308 (GRCm39) splice site probably benign
R9109:Csmd3 UTSW 15 47,617,187 (GRCm39) missense
R9121:Csmd3 UTSW 15 47,683,774 (GRCm39) missense
R9155:Csmd3 UTSW 15 47,449,051 (GRCm39) missense
R9176:Csmd3 UTSW 15 47,864,937 (GRCm39) missense
R9281:Csmd3 UTSW 15 47,460,272 (GRCm39) missense
R9298:Csmd3 UTSW 15 47,617,187 (GRCm39) missense
R9304:Csmd3 UTSW 15 47,569,805 (GRCm39) missense
R9343:Csmd3 UTSW 15 48,015,001 (GRCm39) missense probably damaging 1.00
R9367:Csmd3 UTSW 15 47,567,564 (GRCm39) missense
R9405:Csmd3 UTSW 15 47,539,187 (GRCm39) missense
R9448:Csmd3 UTSW 15 47,460,315 (GRCm39) missense
R9460:Csmd3 UTSW 15 47,617,130 (GRCm39) missense
R9481:Csmd3 UTSW 15 47,470,459 (GRCm39) missense
R9520:Csmd3 UTSW 15 47,561,608 (GRCm39) missense
R9551:Csmd3 UTSW 15 48,655,356 (GRCm39) start gained probably benign
R9552:Csmd3 UTSW 15 48,655,356 (GRCm39) start gained probably benign
R9568:Csmd3 UTSW 15 48,150,942 (GRCm39) missense probably damaging 0.97
R9571:Csmd3 UTSW 15 48,655,398 (GRCm39) start gained probably benign
R9607:Csmd3 UTSW 15 47,618,811 (GRCm39) missense probably damaging 0.98
R9621:Csmd3 UTSW 15 47,713,116 (GRCm39) missense
R9671:Csmd3 UTSW 15 47,845,299 (GRCm39) missense
R9718:Csmd3 UTSW 15 47,560,083 (GRCm39) missense
U24488:Csmd3 UTSW 15 47,573,795 (GRCm39) missense probably damaging 1.00
V8831:Csmd3 UTSW 15 48,321,092 (GRCm39) missense probably damaging 0.96
X0021:Csmd3 UTSW 15 47,833,489 (GRCm39) nonsense probably null
Z1088:Csmd3 UTSW 15 47,710,677 (GRCm39) missense probably damaging 0.98
Z1088:Csmd3 UTSW 15 47,499,789 (GRCm39) missense probably damaging 1.00
Z1177:Csmd3 UTSW 15 47,596,813 (GRCm39) missense
Z1177:Csmd3 UTSW 15 47,539,130 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATGCCAGCTCTTAGTCATTGCAAT -3'
(R):5'- TGCTACTTCTTAGAACAAGCTAGAACA -3'

Sequencing Primer
(F):5'- GCTGCCAGAAGTATCGA -3'
(R):5'- CCTCAGATCAGCTAGAGTATGCTG -3'
Posted On 2015-02-18