Incidental Mutation 'R2870:Vwa7'
ID 266546
Institutional Source Beutler Lab
Gene Symbol Vwa7
Ensembl Gene ENSMUSG00000007030
Gene Name von Willebrand factor A domain containing 7
Synonyms G7c, D17H6S56E-3
MMRRC Submission 040458-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R2870 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35235555-35245717 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35240218 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 395 (M395I)
Ref Sequence ENSEMBL: ENSMUSP00000133418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000040151] [ENSMUST00000087315] [ENSMUST00000172499] [ENSMUST00000174037]
AlphaFold Q9JHA8
Predicted Effect probably damaging
Transcript: ENSMUST00000007245
AA Change: M395I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030
AA Change: M395I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040151
SMART Domains Protein: ENSMUSP00000047448
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
Pfam:Suppressor_APC 35 114 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087315
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172499
AA Change: M395I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030
AA Change: M395I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173211
Predicted Effect probably benign
Transcript: ENSMUST00000174037
SMART Domains Protein: ENSMUSP00000133881
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actrt3 A G 3: 30,653,847 (GRCm39) V51A probably damaging Het
Adgb C T 10: 10,307,025 (GRCm39) probably null Het
Als2 A G 1: 59,250,296 (GRCm39) S483P probably damaging Het
Ankrd10 C T 8: 11,665,682 (GRCm39) R306H probably damaging Het
Arhgef10 T C 8: 15,025,093 (GRCm39) probably null Het
Arhgef10 A G 8: 15,025,666 (GRCm39) I459V probably benign Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp12a A G 14: 56,624,407 (GRCm39) R952G possibly damaging Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
C030034I22Rik T A 17: 69,725,106 (GRCm39) noncoding transcript Het
Cacna2d1 G A 5: 16,517,566 (GRCm39) C404Y probably damaging Het
Ccdc163 T C 4: 116,599,058 (GRCm39) silent Het
Ccdc59 A T 10: 105,677,388 (GRCm39) K9M possibly damaging Het
Cd6 A G 19: 10,771,990 (GRCm39) I307T possibly damaging Het
Cimap1d G A 10: 79,481,487 (GRCm39) T14I probably benign Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Csmd3 C T 15: 47,721,320 (GRCm39) G1437D probably damaging Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Dcp1b C T 6: 119,191,735 (GRCm39) S217L probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Dmp1 A G 5: 104,359,974 (GRCm39) S217G probably benign Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eral1 A G 11: 77,967,104 (GRCm39) I164T possibly damaging Het
Esr1 G A 10: 4,947,890 (GRCm39) R481H probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Gbp11 C T 5: 105,478,866 (GRCm39) D191N probably benign Het
Gm21759 T A 5: 8,230,863 (GRCm39) probably benign Het
Gm5454 C A 13: 103,494,031 (GRCm39) noncoding transcript Het
Gm9874 A T 17: 30,704,763 (GRCm39) probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Gria4 T A 9: 4,503,614 (GRCm39) N334I probably damaging Het
Grm5 T C 7: 87,251,930 (GRCm39) V60A possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ino80d C T 1: 63,100,198 (GRCm39) probably null Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Krt31 T G 11: 99,938,699 (GRCm39) N298T possibly damaging Het
Mapk7 C A 11: 61,381,038 (GRCm39) probably benign Het
Marchf8 C T 6: 116,378,106 (GRCm39) probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mdm1 A G 10: 117,986,847 (GRCm39) T267A probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mtm1 T C X: 70,339,968 (GRCm39) probably benign Homo
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Mylk2 A G 2: 152,761,268 (GRCm39) K457R probably damaging Het
Nell1 A T 7: 49,899,405 (GRCm39) probably benign Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Or10g1 T G 14: 52,648,318 (GRCm39) T4P probably benign Het
Or6c211 A T 10: 129,505,628 (GRCm39) C253* probably null Het
Or8k33 T C 2: 86,383,928 (GRCm39) D180G possibly damaging Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Otud4 T A 8: 80,387,702 (GRCm39) N300K possibly damaging Het
Otx1 A G 11: 21,948,681 (GRCm39) probably benign Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Pcdhb20 A T 18: 37,638,833 (GRCm39) Q453L possibly damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Plcl1 A T 1: 55,736,309 (GRCm39) D550V probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Pold1 C T 7: 44,192,771 (GRCm39) silent Het
Ppp1r7 T A 1: 93,285,585 (GRCm39) probably null Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Pzp A T 6: 128,462,519 (GRCm39) probably null Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Retnla A G 16: 48,663,975 (GRCm39) R90G probably benign Het
Semp2l2b A T 10: 21,943,278 (GRCm39) I234N probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Slc5a8 A G 10: 88,740,825 (GRCm39) I247V probably benign Het
Son A G 16: 91,461,205 (GRCm39) probably null Het
Spcs2 T C 7: 99,488,968 (GRCm39) D240G probably damaging Het
Stx3 A T 19: 11,766,938 (GRCm39) V91D probably damaging Het
Taf6l A G 19: 8,755,992 (GRCm39) probably benign Het
Tafa2 A T 10: 123,540,270 (GRCm39) H42L possibly damaging Het
Tbc1d8 A G 1: 39,444,398 (GRCm39) F187S probably damaging Het
Thbs1 C G 2: 117,949,859 (GRCm39) N611K probably damaging Het
Tipin A C 9: 64,211,609 (GRCm39) S232R probably benign Het
Tmem132b A G 5: 125,715,332 (GRCm39) D347G probably benign Het
Tmem161a C T 8: 70,631,565 (GRCm39) probably benign Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Ybx3 G A 6: 131,347,376 (GRCm39) A253V probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Zzz3 T A 3: 152,152,481 (GRCm39) silent Het
Other mutations in Vwa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Vwa7 APN 17 35,243,918 (GRCm39) missense probably damaging 1.00
IGL01736:Vwa7 APN 17 35,238,827 (GRCm39) missense probably damaging 1.00
IGL01868:Vwa7 APN 17 35,240,235 (GRCm39) missense probably null 0.96
IGL01920:Vwa7 APN 17 35,243,579 (GRCm39) missense probably benign 0.01
IGL02227:Vwa7 APN 17 35,239,060 (GRCm39) missense probably damaging 1.00
IGL02947:Vwa7 APN 17 35,242,476 (GRCm39) splice site probably null
IGL03259:Vwa7 APN 17 35,239,002 (GRCm39) splice site probably null
IGL03263:Vwa7 APN 17 35,240,575 (GRCm39) missense probably benign 0.16
R0008:Vwa7 UTSW 17 35,238,781 (GRCm39) missense probably benign 0.33
R0057:Vwa7 UTSW 17 35,243,523 (GRCm39) missense possibly damaging 0.85
R0057:Vwa7 UTSW 17 35,243,523 (GRCm39) missense possibly damaging 0.85
R0418:Vwa7 UTSW 17 35,236,933 (GRCm39) missense possibly damaging 0.57
R0538:Vwa7 UTSW 17 35,241,627 (GRCm39) missense probably damaging 1.00
R1121:Vwa7 UTSW 17 35,236,770 (GRCm39) missense probably damaging 1.00
R1659:Vwa7 UTSW 17 35,238,047 (GRCm39) missense probably benign 0.04
R1766:Vwa7 UTSW 17 35,242,919 (GRCm39) critical splice donor site probably null
R1777:Vwa7 UTSW 17 35,243,924 (GRCm39) missense probably damaging 1.00
R1793:Vwa7 UTSW 17 35,243,388 (GRCm39) nonsense probably null
R1874:Vwa7 UTSW 17 35,236,088 (GRCm39) missense probably benign 0.00
R2139:Vwa7 UTSW 17 35,242,406 (GRCm39) missense probably benign 0.00
R2248:Vwa7 UTSW 17 35,238,019 (GRCm39) missense probably benign 0.04
R2290:Vwa7 UTSW 17 35,236,187 (GRCm39) missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R2869:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R2870:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R2871:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R2873:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R2874:Vwa7 UTSW 17 35,240,218 (GRCm39) missense probably damaging 1.00
R3038:Vwa7 UTSW 17 35,241,637 (GRCm39) missense probably damaging 1.00
R3792:Vwa7 UTSW 17 35,244,135 (GRCm39) splice site probably null
R3970:Vwa7 UTSW 17 35,236,684 (GRCm39) missense probably damaging 1.00
R4612:Vwa7 UTSW 17 35,242,426 (GRCm39) missense probably damaging 0.96
R5013:Vwa7 UTSW 17 35,241,709 (GRCm39) missense probably damaging 1.00
R5068:Vwa7 UTSW 17 35,243,166 (GRCm39) missense probably benign 0.25
R5069:Vwa7 UTSW 17 35,243,166 (GRCm39) missense probably benign 0.25
R5070:Vwa7 UTSW 17 35,243,166 (GRCm39) missense probably benign 0.25
R5137:Vwa7 UTSW 17 35,236,822 (GRCm39) missense probably damaging 1.00
R5384:Vwa7 UTSW 17 35,243,902 (GRCm39) splice site probably null
R6170:Vwa7 UTSW 17 35,240,186 (GRCm39) missense possibly damaging 0.56
R6229:Vwa7 UTSW 17 35,243,241 (GRCm39) missense probably benign 0.00
R6249:Vwa7 UTSW 17 35,242,365 (GRCm39) missense probably benign 0.00
R6401:Vwa7 UTSW 17 35,236,286 (GRCm39) splice site probably null
R6429:Vwa7 UTSW 17 35,243,175 (GRCm39) missense probably benign 0.32
R6678:Vwa7 UTSW 17 35,238,776 (GRCm39) missense probably damaging 1.00
R6793:Vwa7 UTSW 17 35,243,867 (GRCm39) missense probably benign 0.06
R6966:Vwa7 UTSW 17 35,236,072 (GRCm39) missense probably benign
R7492:Vwa7 UTSW 17 35,238,020 (GRCm39) missense possibly damaging 0.86
R7903:Vwa7 UTSW 17 35,236,763 (GRCm39) missense probably damaging 1.00
R7922:Vwa7 UTSW 17 35,243,409 (GRCm39) missense possibly damaging 0.81
R8191:Vwa7 UTSW 17 35,238,712 (GRCm39) missense probably damaging 0.96
R8728:Vwa7 UTSW 17 35,236,133 (GRCm39) missense probably damaging 1.00
R8961:Vwa7 UTSW 17 35,238,086 (GRCm39) missense probably damaging 1.00
R9037:Vwa7 UTSW 17 35,236,268 (GRCm39) missense probably benign 0.00
R9275:Vwa7 UTSW 17 35,238,712 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCTCTCAGGTGAGTTCTATCC -3'
(R):5'- ACCCTGGAAGGAAGCTGATG -3'

Sequencing Primer
(F):5'- GTTCAGCAGCTAAGAGTACTTGC -3'
(R):5'- CTGGAAGGAAGCTGATGGAACC -3'
Posted On 2015-02-18