Incidental Mutation 'R2870:Cd6'
ID266554
Institutional Source Beutler Lab
Gene Symbol Cd6
Ensembl Gene ENSMUSG00000024670
Gene NameCD6 antigen
Synonyms
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10789341-10830058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10794626 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 307 (I307T)
Ref Sequence ENSEMBL: ENSMUSP00000134639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039043] [ENSMUST00000080292] [ENSMUST00000174176]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000025572
Predicted Effect probably benign
Transcript: ENSMUST00000039043
AA Change: I408T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046861
Gene: ENSMUSG00000024670
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 611 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080292
AA Change: I408T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079172
Gene: ENSMUSG00000024670
AA Change: I408T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
SR 264 360 3.51e-29 SMART
low complexity region 383 394 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173613
Predicted Effect possibly damaging
Transcript: ENSMUST00000174176
AA Change: I307T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134639
Gene: ENSMUSG00000024670
AA Change: I307T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SR 45 155 7.33e-9 SMART
SR 160 259 8.68e-52 SMART
low complexity region 282 293 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
Meta Mutation Damage Score 0.4887 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein found on the outer membrane of T-lymphocytes as well as some other immune cells. The encoded protein contains three scavenger receptor cysteine-rich (SRCR) domains and a binding site for an activated leukocyte cell adhesion molecule. The gene product is important for continuation of T cell activation. This gene may be associated with susceptibility to multiple sclerosis (PMID: 19525953, 21849685). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to insteinal ischemia/reperfusion induced injury due to reduced IgM-producing B1a cell self-renewal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Cd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Cd6 APN 19 10796394 splice site probably benign
IGL01326:Cd6 APN 19 10791102 missense probably benign 0.09
IGL01406:Cd6 APN 19 10791137 missense possibly damaging 0.77
IGL01885:Cd6 APN 19 10799237 missense probably benign
IGL02268:Cd6 APN 19 10796388 missense probably benign 0.03
IGL03100:Cd6 APN 19 10792939 missense probably benign 0.34
R1856:Cd6 UTSW 19 10798602 missense probably damaging 0.98
R2419:Cd6 UTSW 19 10792852 missense probably damaging 1.00
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2869:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2870:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2874:Cd6 UTSW 19 10794626 missense possibly damaging 0.86
R2936:Cd6 UTSW 19 10796322 splice site probably null
R4124:Cd6 UTSW 19 10790608 missense probably damaging 1.00
R4748:Cd6 UTSW 19 10794225 nonsense probably null
R6665:Cd6 UTSW 19 10791003 missense probably benign 0.03
R6720:Cd6 UTSW 19 10794609 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGCATGCTGGGAAAATCTTTC -3'
(R):5'- AAGTGGATCAGTTCATGGGTAG -3'

Sequencing Primer
(F):5'- TCCCACCATCAAGAGGTTTGG -3'
(R):5'- TGGATCAGTTCATGGGTAGAAAGTC -3'
Posted On2015-02-18