Incidental Mutation 'R2871:Cyp4a14'
ID266575
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2871 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115486200-115496142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115487301 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 456 (G456W)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: G456W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: G456W

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Amdhd2 A G 17: 24,157,855 probably benign Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Ccnb1-ps C A 7: 42,106,075 noncoding transcript Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Habp2 T A 19: 56,287,991 probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Mapk7 C A 11: 61,490,212 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Nell1 A T 7: 50,249,657 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pcnx3 A T 19: 5,683,746 probably benign Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Son A G 16: 91,664,317 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115489952 splice site probably benign
IGL01539:Cyp4a14 APN 4 115487177 missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115494937 nonsense probably null
IGL02309:Cyp4a14 APN 4 115491632 missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115495027 splice site probably benign
IGL03302:Cyp4a14 APN 4 115491378 missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115489996 missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115492170 missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115491134 missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115495936 missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115495929 missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115493609 missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115491410 missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115496100 nonsense probably null
R6269:Cyp4a14 UTSW 4 115491131 missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115487244 missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115496083 missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115489959 splice site probably null
R6563:Cyp4a14 UTSW 4 115492086 missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115491194 missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115491081 missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115491161 missense probably damaging 1.00
R7544:Cyp4a14 UTSW 4 115491086 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGACACATTGCAGAGAGC -3'
(R):5'- AGCCTATGCGCAGAGACAAG -3'

Sequencing Primer
(F):5'- AGCAGACCTCTGGAGCTG -3'
(R):5'- TCGTGTGACCTATAAGGAAAGTGATC -3'
Posted On2015-02-18