Incidental Mutation 'R2872:Plcl1'
ID266636
Institutional Source Beutler Lab
Gene Symbol Plcl1
Ensembl Gene ENSMUSG00000038349
Gene Namephospholipase C-like 1
SynonymsPRIP-1, C230017K02Rik, PLC-L
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R2872 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location55405921-55754285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55697150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 550 (D550V)
Ref Sequence ENSEMBL: ENSMUSP00000037854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042986]
Predicted Effect probably benign
Transcript: ENSMUST00000042986
AA Change: D550V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: D550V

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
PH 115 226 6.98e-4 SMART
low complexity region 301 310 N/A INTRINSIC
Pfam:EF-hand_like 316 398 5.9e-27 PFAM
PLCXc 399 543 2.13e-82 SMART
low complexity region 550 564 N/A INTRINSIC
PLCYc 586 702 2.15e-69 SMART
C2 723 829 1.02e-21 SMART
low complexity region 1080 1092 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187059
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,154,756 probably benign Het
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Akr1e1 G A 13: 4,602,684 silent Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Carmil1 G A 13: 24,045,068 silent Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gm21759 T A 5: 8,180,863 probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Knop1 T C 7: 118,855,963 probably null Het
Mapk7 C A 11: 61,490,212 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Plxna3 T A X: 74,339,396 probably benign Homo
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Prps1 C T X: 140,471,994 probably benign Homo
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Son A G 16: 91,664,317 probably null Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Plcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Plcl1 APN 1 55406536 missense probably benign
IGL00491:Plcl1 APN 1 55713498 critical splice donor site probably null
IGL00753:Plcl1 APN 1 55696738 missense probably damaging 1.00
IGL01415:Plcl1 APN 1 55696396 missense possibly damaging 0.92
IGL03024:Plcl1 APN 1 55695787 missense probably damaging 1.00
K3955:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
PIT4791001:Plcl1 UTSW 1 55701931 missense probably benign 0.03
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0083:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R0086:Plcl1 UTSW 1 55715583 missense probably damaging 1.00
R0092:Plcl1 UTSW 1 55696765 missense probably damaging 0.98
R0108:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R1716:Plcl1 UTSW 1 55695838 missense probably damaging 0.99
R2061:Plcl1 UTSW 1 55751345 missense probably benign 0.01
R2128:Plcl1 UTSW 1 55697838 missense probably damaging 1.00
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2873:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R3819:Plcl1 UTSW 1 55696599 missense probably benign
R3974:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R3975:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R4214:Plcl1 UTSW 1 55751335 nonsense probably null
R4400:Plcl1 UTSW 1 55715577 missense probably damaging 1.00
R4452:Plcl1 UTSW 1 55696886 missense probably benign 0.00
R4615:Plcl1 UTSW 1 55698134 missense probably benign 0.00
R5060:Plcl1 UTSW 1 55696512 missense possibly damaging 0.84
R5422:Plcl1 UTSW 1 55697384 missense probably benign 0.00
R5568:Plcl1 UTSW 1 55696150 missense possibly damaging 0.82
R5781:Plcl1 UTSW 1 55695989 missense possibly damaging 0.92
R5809:Plcl1 UTSW 1 55696001 missense probably damaging 1.00
R6009:Plcl1 UTSW 1 55696246 missense probably damaging 1.00
R6339:Plcl1 UTSW 1 55696315 missense probably damaging 1.00
R6431:Plcl1 UTSW 1 55697252 missense probably benign 0.03
R6534:Plcl1 UTSW 1 55696748 missense probably damaging 1.00
R6565:Plcl1 UTSW 1 55697958 nonsense probably null
R6678:Plcl1 UTSW 1 55695776 missense probably benign 0.13
R6773:Plcl1 UTSW 1 55751302 missense probably benign 0.03
R6925:Plcl1 UTSW 1 55406598 nonsense probably null
R7168:Plcl1 UTSW 1 55697463 missense probably damaging 1.00
R7256:Plcl1 UTSW 1 55698218 missense probably benign 0.45
R7522:Plcl1 UTSW 1 55696364 missense probably benign 0.31
R7527:Plcl1 UTSW 1 55697114 missense probably damaging 1.00
R7536:Plcl1 UTSW 1 55713481 nonsense probably null
R7585:Plcl1 UTSW 1 55406449 missense probably benign 0.00
R7591:Plcl1 UTSW 1 55697449 missense probably benign 0.01
R7689:Plcl1 UTSW 1 55697468 missense probably damaging 1.00
R7960:Plcl1 UTSW 1 55697284 missense possibly damaging 0.48
R8029:Plcl1 UTSW 1 55696078 missense probably benign 0.26
R8241:Plcl1 UTSW 1 55695817 missense probably benign 0.01
R8323:Plcl1 UTSW 1 55697736 missense possibly damaging 0.58
Z1176:Plcl1 UTSW 1 55696040 missense probably benign 0.20
Z1176:Plcl1 UTSW 1 55751284 nonsense probably null
Z1177:Plcl1 UTSW 1 55696884 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTCTCTGCTTGGGGAATCACTG -3'
(R):5'- GCTGGCCTCTGTTTCACTAAATG -3'

Sequencing Primer
(F):5'- GCTTGGGGAATCACTGCTCTC -3'
(R):5'- GAACACATTTCCCAGTAGTTTTGG -3'
Posted On2015-02-18