Incidental Mutation 'R2872:Cyp4a14'
ID 266658
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 040460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R2872 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115344498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 456 (G456W)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: G456W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: G456W

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Meta Mutation Damage Score 0.9436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,201,530 (GRCm39) probably benign Het
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Ak8 T C 2: 28,632,732 (GRCm39) I317T possibly damaging Het
Akr1e1 G A 13: 4,652,683 (GRCm39) silent Het
Als2 A G 1: 59,250,296 (GRCm39) S483P probably damaging Het
Arhgef10 T C 8: 15,025,093 (GRCm39) probably null Het
Arhgef10 A G 8: 15,025,666 (GRCm39) I459V probably benign Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp12a A G 14: 56,624,407 (GRCm39) R952G possibly damaging Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Carmil1 G A 13: 24,229,051 (GRCm39) silent Het
Cilk1 A T 9: 78,047,382 (GRCm39) probably null Het
Col12a1 A T 9: 79,606,831 (GRCm39) F531I probably damaging Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Ctnnd1 C T 2: 84,451,232 (GRCm39) V123I possibly damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Homo
Gm21759 T A 5: 8,230,863 (GRCm39) probably benign Het
Gm37340 G A 2: 6,955,739 (GRCm39) probably benign Het
Gpr156 T A 16: 37,812,585 (GRCm39) V307D probably damaging Het
Gpr35 G A 1: 92,910,848 (GRCm39) V187I probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Hdac10 G T 15: 89,010,059 (GRCm39) Q300K possibly damaging Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Igsf9b A G 9: 27,233,519 (GRCm39) I340V probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Homo
Knop1 T C 7: 118,455,186 (GRCm39) probably null Het
Mapk7 C A 11: 61,381,038 (GRCm39) probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mideas C T 12: 84,203,245 (GRCm39) G886S probably benign Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b T C 8: 71,743,610 (GRCm39) Y224H probably benign Het
Nav1 A G 1: 135,388,495 (GRCm39) silent Het
Ndufs1 A G 1: 63,203,882 (GRCm39) probably benign Het
Nlrc3 T C 16: 3,775,190 (GRCm39) D774G possibly damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Nox3 T C 17: 3,733,191 (GRCm39) H240R probably damaging Het
Nsun2 A G 13: 69,777,801 (GRCm39) T425A probably damaging Het
Or10g1 T G 14: 52,648,318 (GRCm39) T4P probably benign Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or1o4 A G 17: 37,590,867 (GRCm39) V148A possibly damaging Het
Or52u1 T C 7: 104,237,700 (GRCm39) S230P possibly damaging Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Otud4 T A 8: 80,387,702 (GRCm39) N300K possibly damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Paqr5 A T 9: 61,876,061 (GRCm39) probably null Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pkd1l2 C T 8: 117,764,903 (GRCm39) V1332I probably benign Het
Plcl1 A T 1: 55,736,309 (GRCm39) D550V probably benign Het
Plekhg1 T G 10: 3,913,982 (GRCm39) S1235A probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Plxna3 T A X: 73,383,002 (GRCm39) probably benign Homo
Polg2 A G 11: 106,666,251 (GRCm39) probably null Het
Ppp1r7 T A 1: 93,285,585 (GRCm39) probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Homo
Prps1 C T X: 139,372,743 (GRCm39) probably benign Homo
Rapgef6 T A 11: 54,552,001 (GRCm39) F956L probably damaging Het
Rasl12 A G 9: 65,315,605 (GRCm39) N83S probably benign Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Sel1l3 C T 5: 53,295,225 (GRCm39) W792* probably null Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Slc6a9 T A 4: 117,706,578 (GRCm39) M1K probably null Het
Smpdl3a T A 10: 57,678,626 (GRCm39) F143Y possibly damaging Het
Son A G 16: 91,461,205 (GRCm39) probably null Het
Spsb4 G T 9: 96,878,071 (GRCm39) T84K probably damaging Het
Tbc1d8 A G 1: 39,444,398 (GRCm39) F187S probably damaging Het
Tdpoz3 T A 3: 93,733,735 (GRCm39) F137I probably benign Het
Tgm7 G A 2: 120,940,174 (GRCm39) probably benign Het
Tmem161a C T 8: 70,631,565 (GRCm39) probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Tpd52 A T 3: 9,068,466 (GRCm39) Y16* probably null Het
Trpa1 A G 1: 14,957,844 (GRCm39) C705R probably damaging Het
Ttn A G 2: 76,581,195 (GRCm39) S23233P probably damaging Het
Uevld T C 7: 46,597,693 (GRCm39) D154G probably null Het
Zfp292 G A 4: 34,808,595 (GRCm39) T1483M probably damaging Het
Zzz3 T A 3: 152,152,481 (GRCm39) silent Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGGACACATTGCAGAGAGC -3'
(R):5'- AGCCTATGCGCAGAGACAAG -3'

Sequencing Primer
(F):5'- AGCAGACCTCTGGAGCTG -3'
(R):5'- TCGTGTGACCTATAAGGAAAGTGATC -3'
Posted On 2015-02-18