Incidental Mutation 'R2872:Olfr99'
ID266701
Institutional Source Beutler Lab
Gene Symbol Olfr99
Ensembl Gene ENSMUSG00000061972
Gene Nameolfactory receptor 99
SynonymsMOR156-1, GA_x6K02T2PSCP-1720261-1719344
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2872 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37279043-37283460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37279976 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000148900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077585] [ENSMUST00000216328]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077585
AA Change: V148A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076781
Gene: ENSMUSG00000061972
AA Change: V148A

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-58 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.4e-6 PFAM
Pfam:7tm_1 38 287 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Predicted Effect possibly damaging
Transcript: ENSMUST00000216328
AA Change: V148A

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216370
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,154,756 probably benign Het
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Akr1e1 G A 13: 4,602,684 silent Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Carmil1 G A 13: 24,045,068 silent Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Homo
Gm21759 T A 5: 8,180,863 probably benign Het
Gm37340 G A 2: 6,950,928 probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Homo
Knop1 T C 7: 118,855,963 probably null Het
Mapk7 C A 11: 61,490,212 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nav1 A G 1: 135,460,757 silent Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Plxna3 T A X: 74,339,396 probably benign Homo
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Homo
Prps1 C T X: 140,471,994 probably benign Homo
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Son A G 16: 91,664,317 probably null Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Olfr99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr99 APN 17 37280000 missense possibly damaging 0.46
IGL02954:Olfr99 APN 17 37280304 missense probably damaging 1.00
R0533:Olfr99 UTSW 17 37280291 nonsense probably null
R1480:Olfr99 UTSW 17 37279745 missense probably benign 0.01
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R3772:Olfr99 UTSW 17 37279854 missense probably benign 0.00
R3826:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3827:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3829:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R5210:Olfr99 UTSW 17 37279933 missense probably benign 0.13
R5361:Olfr99 UTSW 17 37279610 missense probably benign 0.02
R6213:Olfr99 UTSW 17 37280373 missense probably benign
R6399:Olfr99 UTSW 17 37279775 missense probably damaging 1.00
R6881:Olfr99 UTSW 17 37280309 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGAGAACCGCACTGATTCC -3'
(R):5'- TAAAATGCTGGAGGCTCTGTGG -3'

Sequencing Primer
(F):5'- GAGAACCGCACTGATTCCTAAAATTC -3'
(R):5'- GGACTGGAGATGGATCAATCTCATTC -3'
Posted On2015-02-18