Incidental Mutation 'R3414:Mrps5'
ID 266718
Institutional Source Beutler Lab
Gene Symbol Mrps5
Ensembl Gene ENSMUSG00000027374
Gene Name mitochondrial ribosomal protein S5
Synonyms
MMRRC Submission 040632-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3414 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 127587222-127606829 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127596912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000028852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028852] [ENSMUST00000146131]
AlphaFold Q99N87
Predicted Effect probably benign
Transcript: ENSMUST00000028852
AA Change: D219G

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: D219G

DomainStartEndE-ValueType
low complexity region 108 126 N/A INTRINSIC
Pfam:Ribosomal_S5 220 285 3.5e-20 PFAM
Pfam:Ribosomal_S5_C 297 368 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145271
Predicted Effect probably benign
Transcript: ENSMUST00000146131
SMART Domains Protein: ENSMUSP00000119674
Gene: ENSMUSG00000027374

DomainStartEndE-ValueType
low complexity region 100 118 N/A INTRINSIC
Meta Mutation Damage Score 0.2007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
AW554918 C A 18: 25,400,072 T261K possibly damaging Het
Cttnbp2 A G 6: 18,389,205 V1178A probably benign Het
Ddx18 T C 1: 121,562,149 N177S probably benign Het
Dhx29 A G 13: 112,947,273 K621E probably damaging Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Eef2 G T 10: 81,177,858 R66L probably damaging Het
Ergic2 A G 6: 148,206,681 probably benign Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Ifi202b A G 1: 173,963,913 S400P probably benign Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Il7 G T 3: 7,576,033 Q67K probably benign Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Klk1b26 A G 7: 44,016,873 I247V probably benign Het
Klrc1 A G 6: 129,677,763 probably null Het
Lama1 T C 17: 67,737,603 C166R probably damaging Het
Mtus1 T C 8: 41,048,063 T806A probably damaging Het
Naip2 G A 13: 100,189,263 R46* probably null Het
Nos2 A T 11: 78,957,588 Y1107F probably benign Het
Nsd3 T C 8: 25,700,019 I135T probably damaging Het
Olfr156 C T 4: 43,821,258 M34I probably benign Het
Olfr710 G T 7: 106,944,176 S275* probably null Het
Olfr808 A G 10: 129,768,432 H312R probably benign Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppip5k1 A T 2: 121,327,661 S252R probably damaging Het
Proc T A 18: 32,123,685 T310S probably benign Het
Psg21 A T 7: 18,652,380 L227Q probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sec24a T A 11: 51,729,458 N456Y probably damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Unc13b T A 4: 43,234,658 probably benign Het
Vmn1r2 T A 4: 3,172,696 M205K probably damaging Het
Zfhx4 A G 3: 5,403,823 K3014E probably damaging Het
Other mutations in Mrps5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Mrps5 APN 2 127591907 missense probably null 0.01
IGL03348:Mrps5 APN 2 127601385 missense probably damaging 0.98
R0369:Mrps5 UTSW 2 127591829 missense probably benign 0.09
R0485:Mrps5 UTSW 2 127591825 missense possibly damaging 0.56
R0622:Mrps5 UTSW 2 127594531 missense probably benign 0.00
R1954:Mrps5 UTSW 2 127596897 splice site probably null
R2182:Mrps5 UTSW 2 127602487 missense probably damaging 1.00
R4007:Mrps5 UTSW 2 127591835 missense possibly damaging 0.81
R4687:Mrps5 UTSW 2 127590770 missense probably benign 0.44
R4780:Mrps5 UTSW 2 127598241 missense probably benign 0.00
R4835:Mrps5 UTSW 2 127603707 missense possibly damaging 0.84
R4851:Mrps5 UTSW 2 127590745 missense probably benign 0.00
R5076:Mrps5 UTSW 2 127600852 nonsense probably null
R5558:Mrps5 UTSW 2 127602435 missense probably damaging 1.00
R6192:Mrps5 UTSW 2 127601385 missense probably damaging 0.98
R7038:Mrps5 UTSW 2 127600866 missense probably damaging 1.00
R7071:Mrps5 UTSW 2 127600852 nonsense probably null
R7103:Mrps5 UTSW 2 127601410 missense probably damaging 0.99
R7177:Mrps5 UTSW 2 127595697 missense probably benign
R7319:Mrps5 UTSW 2 127595842 missense possibly damaging 0.94
R7387:Mrps5 UTSW 2 127600884 missense probably damaging 1.00
R7460:Mrps5 UTSW 2 127591891 missense not run
R8211:Mrps5 UTSW 2 127603724 missense probably benign
R9052:Mrps5 UTSW 2 127591956 splice site probably benign
R9358:Mrps5 UTSW 2 127595814 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GAGGACCTGAGACTTAGTAACATTG -3'
(R):5'- AACGCAGCATCGAGTCTCAC -3'

Sequencing Primer
(F):5'- CCTGAGACTTAGTAACATTGGAGTC -3'
(R):5'- AGCATCGAGTCTCACTGCCTC -3'
Posted On 2015-02-18