Incidental Mutation 'R3414:Nsd3'
ID266734
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission 040632-MU
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R3414 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25700019 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000123028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000153597]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084026
AA Change: I1086T

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: I1086T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129959
Predicted Effect possibly damaging
Transcript: ENSMUST00000139966
AA Change: I1037T

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: I1037T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142395
AA Change: I1086T

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: I1086T

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147935
Predicted Effect probably damaging
Transcript: ENSMUST00000153597
AA Change: I135T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123028
Gene: ENSMUSG00000054823
AA Change: I135T

DomainStartEndE-ValueType
PWWP 17 79 8.62e-18 SMART
AWS 152 203 2.61e-17 SMART
SET 204 327 2.17e-41 SMART
PostSET 328 344 2.63e-3 SMART
low complexity region 358 375 N/A INTRINSIC
PHD 381 424 4.32e-9 SMART
Meta Mutation Damage Score 0.1600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
AW554918 C A 18: 25,400,072 T261K possibly damaging Het
Cttnbp2 A G 6: 18,389,205 V1178A probably benign Het
Ddx18 T C 1: 121,562,149 N177S probably benign Het
Dhx29 A G 13: 112,947,273 K621E probably damaging Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Eef2 G T 10: 81,177,858 R66L probably damaging Het
Ergic2 A G 6: 148,206,681 probably benign Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Ifi202b A G 1: 173,963,913 S400P probably benign Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Il7 G T 3: 7,576,033 Q67K probably benign Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Klk1b26 A G 7: 44,016,873 I247V probably benign Het
Klrc1 A G 6: 129,677,763 probably null Het
Lama1 T C 17: 67,737,603 C166R probably damaging Het
Mrps5 A G 2: 127,596,912 D219G probably benign Het
Mtus1 T C 8: 41,048,063 T806A probably damaging Het
Naip2 G A 13: 100,189,263 R46* probably null Het
Nos2 A T 11: 78,957,588 Y1107F probably benign Het
Olfr156 C T 4: 43,821,258 M34I probably benign Het
Olfr710 G T 7: 106,944,176 S275* probably null Het
Olfr808 A G 10: 129,768,432 H312R probably benign Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppip5k1 A T 2: 121,327,661 S252R probably damaging Het
Proc T A 18: 32,123,685 T310S probably benign Het
Psg21 A T 7: 18,652,380 L227Q probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sec24a T A 11: 51,729,458 N456Y probably damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Unc13b T A 4: 43,234,658 probably benign Het
Vmn1r2 T A 4: 3,172,696 M205K probably damaging Het
Zfhx4 A G 3: 5,403,823 K3014E probably damaging Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R5911:Nsd3 UTSW 8 25666076 missense probably damaging 1.00
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
R7678:Nsd3 UTSW 8 25659817 missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 25682562 missense probably benign
R8064:Nsd3 UTSW 8 25700670 nonsense probably null
R8547:Nsd3 UTSW 8 25694784 missense probably damaging 1.00
R8954:Nsd3 UTSW 8 25673378 missense probably damaging 1.00
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGCGTGTCTAGGATGGTAG -3'
(R):5'- TACCTGAAATCAAGGGACAATGTC -3'

Sequencing Primer
(F):5'- GATGGTAGAATGTAACTTCCCACGC -3'
(R):5'- TGTCTGGAAAAGGAAGGCTAAAGGTC -3'
Posted On2015-02-18