Incidental Mutation 'R3414:Naip2'
ID 266742
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene Name NLR family, apoptosis inhibitory protein 2
Synonyms Birc1b, Naip2, Naip-rs6
MMRRC Submission 040632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R3414 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 100144063-100202092 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 100189263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 46 (R46*)
Ref Sequence ENSEMBL: ENSMUSP00000125852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
AlphaFold Q9QUK4
Predicted Effect probably null
Transcript: ENSMUST00000067975
AA Change: R46*
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: R46*

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117913
AA Change: R46*
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: R46*

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167986
AA Change: R46*
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: R46*

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
AW554918 C A 18: 25,400,072 T261K possibly damaging Het
Cttnbp2 A G 6: 18,389,205 V1178A probably benign Het
Ddx18 T C 1: 121,562,149 N177S probably benign Het
Dhx29 A G 13: 112,947,273 K621E probably damaging Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Eef2 G T 10: 81,177,858 R66L probably damaging Het
Ergic2 A G 6: 148,206,681 probably benign Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Ifi202b A G 1: 173,963,913 S400P probably benign Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Il7 G T 3: 7,576,033 Q67K probably benign Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Klk1b26 A G 7: 44,016,873 I247V probably benign Het
Klrc1 A G 6: 129,677,763 probably null Het
Lama1 T C 17: 67,737,603 C166R probably damaging Het
Mrps5 A G 2: 127,596,912 D219G probably benign Het
Mtus1 T C 8: 41,048,063 T806A probably damaging Het
Nos2 A T 11: 78,957,588 Y1107F probably benign Het
Nsd3 T C 8: 25,700,019 I135T probably damaging Het
Olfr156 C T 4: 43,821,258 M34I probably benign Het
Olfr710 G T 7: 106,944,176 S275* probably null Het
Olfr808 A G 10: 129,768,432 H312R probably benign Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppip5k1 A T 2: 121,327,661 S252R probably damaging Het
Proc T A 18: 32,123,685 T310S probably benign Het
Psg21 A T 7: 18,652,380 L227Q probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sec24a T A 11: 51,729,458 N456Y probably damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Unc13b T A 4: 43,234,658 probably benign Het
Vmn1r2 T A 4: 3,172,696 M205K probably damaging Het
Zfhx4 A G 3: 5,403,823 K3014E probably damaging Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
R7699:Naip2 UTSW 13 100160369 missense probably benign 0.00
R7840:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7874:Naip2 UTSW 13 100154951 missense probably benign 0.00
R7874:Naip2 UTSW 13 100154960 missense probably benign
R8038:Naip2 UTSW 13 100162062 missense probably benign 0.00
R8065:Naip2 UTSW 13 100189222 missense probably damaging 1.00
R8094:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8166:Naip2 UTSW 13 100162007 missense probably benign 0.03
R8378:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8669:Naip2 UTSW 13 100188969 missense probably benign 0.05
R8691:Naip2 UTSW 13 100161168 missense probably damaging 1.00
R8716:Naip2 UTSW 13 100144406 missense probably benign
R8720:Naip2 UTSW 13 100162122 missense probably benign 0.04
R8888:Naip2 UTSW 13 100189136 missense probably benign 0.01
R8895:Naip2 UTSW 13 100189136 missense probably benign 0.01
R9031:Naip2 UTSW 13 100178268 missense possibly damaging 0.55
R9072:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9072:Naip2 UTSW 13 100154960 missense probably benign
R9074:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9074:Naip2 UTSW 13 100154960 missense probably benign
R9077:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9077:Naip2 UTSW 13 100154960 missense probably benign
R9176:Naip2 UTSW 13 100162199 missense probably damaging 1.00
R9219:Naip2 UTSW 13 100160705 missense probably benign 0.06
R9358:Naip2 UTSW 13 100161572 missense probably damaging 1.00
R9371:Naip2 UTSW 13 100161846 nonsense probably null
R9414:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9415:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9416:Naip2 UTSW 13 100161735 missense probably damaging 1.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Z1176:Naip2 UTSW 13 100161593 missense probably benign 0.02
Z1176:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100152629 missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100162865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAACTCACATTCTGGTCGTAA -3'
(R):5'- AACACCAACCATCTGCTTTCCT -3'

Sequencing Primer
(F):5'- AAGTTTCCTGAGTCTGGTGGAAAAG -3'
(R):5'- ACCATCTGCTTTCCTTTCTCATTTAG -3'
Posted On 2015-02-18