Incidental Mutation 'R3414:3425401B19Rik'
ID266744
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission 040632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3414 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32661602 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 802 (Q802L)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: Q802L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: Q802L

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
AW554918 C A 18: 25,400,072 T261K possibly damaging Het
Cttnbp2 A G 6: 18,389,205 V1178A probably benign Het
Ddx18 T C 1: 121,562,149 N177S probably benign Het
Dhx29 A G 13: 112,947,273 K621E probably damaging Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Eef2 G T 10: 81,177,858 R66L probably damaging Het
Ergic2 A G 6: 148,206,681 probably benign Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Ifi202b A G 1: 173,963,913 S400P probably benign Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Il7 G T 3: 7,576,033 Q67K probably benign Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Klk1b26 A G 7: 44,016,873 I247V probably benign Het
Klrc1 A G 6: 129,677,763 probably null Het
Lama1 T C 17: 67,737,603 C166R probably damaging Het
Mrps5 A G 2: 127,596,912 D219G probably benign Het
Mtus1 T C 8: 41,048,063 T806A probably damaging Het
Naip2 G A 13: 100,189,263 R46* probably null Het
Nos2 A T 11: 78,957,588 Y1107F probably benign Het
Nsd3 T C 8: 25,700,019 I135T probably damaging Het
Olfr156 C T 4: 43,821,258 M34I probably benign Het
Olfr710 G T 7: 106,944,176 S275* probably null Het
Olfr808 A G 10: 129,768,432 H312R probably benign Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppip5k1 A T 2: 121,327,661 S252R probably damaging Het
Proc T A 18: 32,123,685 T310S probably benign Het
Psg21 A T 7: 18,652,380 L227Q probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sec24a T A 11: 51,729,458 N456Y probably damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Unc13b T A 4: 43,234,658 probably benign Het
Vmn1r2 T A 4: 3,172,696 M205K probably damaging Het
Zfhx4 A G 3: 5,403,823 K3014E probably damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R7784:3425401B19Rik UTSW 14 32659840 missense probably benign 0.00
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGCTCAGTGAGTCCTCTG -3'
(R):5'- GTATGCTTTACAGAAGGCCCC -3'

Sequencing Primer
(F):5'- ATAATAGGCTTTATCACCGGGG -3'
(R):5'- TTTACAGAAGGCCCCCAGGAAG -3'
Posted On2015-02-18