Incidental Mutation 'R3414:AW554918'
ID266748
Institutional Source Beutler Lab
Gene Symbol AW554918
Ensembl Gene ENSMUSG00000033632
Gene Nameexpressed sequence AW554918
Synonyms
MMRRC Submission 040632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3414 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location25168999-25467321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25400072 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 261 (T261K)
Ref Sequence ENSEMBL: ENSMUSP00000097708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036619] [ENSMUST00000097643] [ENSMUST00000100131] [ENSMUST00000159605] [ENSMUST00000160530] [ENSMUST00000165400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036619
AA Change: T464K

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046227
Gene: ENSMUSG00000033632
AA Change: T464K

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.4e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097643
AA Change: T497K

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095248
Gene: ENSMUSG00000033632
AA Change: T497K

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 2.5e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100131
AA Change: T261K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097708
Gene: ENSMUSG00000033632
AA Change: T261K

DomainStartEndE-ValueType
Pfam:KIAA1328 1 211 9.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159605
Predicted Effect probably benign
Transcript: ENSMUST00000160530
Predicted Effect possibly damaging
Transcript: ENSMUST00000165400
AA Change: T497K

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128437
Gene: ENSMUSG00000033632
AA Change: T497K

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.6e-160 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Cttnbp2 A G 6: 18,389,205 V1178A probably benign Het
Ddx18 T C 1: 121,562,149 N177S probably benign Het
Dhx29 A G 13: 112,947,273 K621E probably damaging Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Eef2 G T 10: 81,177,858 R66L probably damaging Het
Ergic2 A G 6: 148,206,681 probably benign Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Ifi202b A G 1: 173,963,913 S400P probably benign Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Il7 G T 3: 7,576,033 Q67K probably benign Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Klk1b26 A G 7: 44,016,873 I247V probably benign Het
Klrc1 A G 6: 129,677,763 probably null Het
Lama1 T C 17: 67,737,603 C166R probably damaging Het
Mrps5 A G 2: 127,596,912 D219G probably benign Het
Mtus1 T C 8: 41,048,063 T806A probably damaging Het
Naip2 G A 13: 100,189,263 R46* probably null Het
Nos2 A T 11: 78,957,588 Y1107F probably benign Het
Nsd3 T C 8: 25,700,019 I135T probably damaging Het
Olfr156 C T 4: 43,821,258 M34I probably benign Het
Olfr710 G T 7: 106,944,176 S275* probably null Het
Olfr808 A G 10: 129,768,432 H312R probably benign Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppip5k1 A T 2: 121,327,661 S252R probably damaging Het
Proc T A 18: 32,123,685 T310S probably benign Het
Psg21 A T 7: 18,652,380 L227Q probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sec24a T A 11: 51,729,458 N456Y probably damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Unc13b T A 4: 43,234,658 probably benign Het
Vmn1r2 T A 4: 3,172,696 M205K probably damaging Het
Zfhx4 A G 3: 5,403,823 K3014E probably damaging Het
Other mutations in AW554918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:AW554918 APN 18 25420065 nonsense probably null
IGL01443:AW554918 APN 18 25344955 missense probably damaging 1.00
IGL01973:AW554918 APN 18 25419999 missense probably damaging 1.00
IGL02743:AW554918 APN 18 25289944 nonsense probably null
PIT4802001:AW554918 UTSW 18 25340075 missense possibly damaging 0.90
R0081:AW554918 UTSW 18 25344902 missense probably benign 0.00
R0567:AW554918 UTSW 18 25400035 missense possibly damaging 0.83
R0709:AW554918 UTSW 18 25463654 missense probably damaging 1.00
R1052:AW554918 UTSW 18 25420010 missense probably benign 0.05
R1418:AW554918 UTSW 18 25339699 splice site probably null
R1530:AW554918 UTSW 18 25400104 missense probably damaging 0.97
R2406:AW554918 UTSW 18 25340287 missense possibly damaging 0.95
R3815:AW554918 UTSW 18 25400047 missense probably benign 0.42
R4683:AW554918 UTSW 18 25339795 missense probably benign 0.04
R4722:AW554918 UTSW 18 25174715 nonsense probably null
R4843:AW554918 UTSW 18 25340000 missense probably benign 0.00
R5199:AW554918 UTSW 18 25340299 missense probably damaging 1.00
R5279:AW554918 UTSW 18 25175431 missense possibly damaging 0.95
R5580:AW554918 UTSW 18 25339865 missense probably damaging 1.00
R7259:AW554918 UTSW 18 25289849 intron probably null
R7388:AW554918 UTSW 18 25340113 missense probably benign 0.05
R7399:AW554918 UTSW 18 25169060 missense possibly damaging 0.67
R8249:AW554918 UTSW 18 25339718 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCCATAGTTGTATTGAAACTCATGC -3'
(R):5'- TGAGAATCTAGTGGCTGGGC -3'

Sequencing Primer
(F):5'- ATATGATCTGTGTTTTTCCCTGTGC -3'
(R):5'- CCACAGCTTTCCAGGCATATG -3'
Posted On2015-02-18