Incidental Mutation 'R3415:Ifi203'
ID266751
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission 040633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3415 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 173928760 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 486 (R486*)
Ref Sequence ENSEMBL: ENSMUSP00000122424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect probably null
Transcript: ENSMUST00000129829
AA Change: R486*
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: R486*

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138143
Predicted Effect probably benign
Transcript: ENSMUST00000156895
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 C G 3: 33,814,497 L813F probably benign Het
Cdh13 A T 8: 118,675,207 D116V probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Chga A G 12: 102,562,784 E340G probably benign Het
Cmip T A 8: 117,349,377 probably null Het
Cnga4 A G 7: 105,407,118 Y309C probably damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Dph6 C T 2: 114,518,287 V267I probably benign Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lims2 A T 18: 31,944,155 Y58F probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp1a A T 9: 7,464,869 K34N possibly damaging Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
P2rx5 G T 11: 73,160,660 V22L possibly damaging Het
Pnmal1 A G 7: 16,960,954 R245G possibly damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Specc1 A G 11: 62,118,419 T334A probably benign Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tm7sf2 A G 19: 6,063,599 Y301H probably damaging Het
Unc13c G T 9: 73,932,586 H328N probably benign Het
Zfp641 T C 15: 98,290,540 D153G probably benign Het
Zp3 A G 5: 135,985,660 T278A probably benign Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCCTTGTGTCAATGGAG -3'
(R):5'- TCCTAAAGTTGCATCCTCCAG -3'

Sequencing Primer
(F):5'- GGTGCACTTATTTCTGGACAC -3'
(R):5'- GTTGCATCCTCCAGCAACAG -3'
Posted On2015-02-18