Incidental Mutation 'R3415:Tas2r124'
ID266762
Institutional Source Beutler Lab
Gene Symbol Tas2r124
Ensembl Gene ENSMUSG00000060412
Gene Nametaste receptor, type 2, member 124
SynonymsT2R24, mGR24, mt2r50, Tas2r24
MMRRC Submission 040633-MU
Accession Numbers

NCBI RefSeq: NM_207026.1; MGI:2681267

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3415 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132754730-132755659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132755638 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 303 (R303S)
Ref Sequence ENSEMBL: ENSMUSP00000075509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076150]
Predicted Effect probably benign
Transcript: ENSMUST00000076150
AA Change: R303S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075509
Gene: ENSMUSG00000060412
AA Change: R303S

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 2.3e-92 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 C G 3: 33,814,497 L813F probably benign Het
Cdh13 A T 8: 118,675,207 D116V probably benign Het
Cep170 G T 1: 176,756,044 P923Q probably damaging Het
Chga A G 12: 102,562,784 E340G probably benign Het
Cmip T A 8: 117,349,377 probably null Het
Cnga4 A G 7: 105,407,118 Y309C probably damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Dph6 C T 2: 114,518,287 V267I probably benign Het
Ero1l T C 14: 45,287,866 T401A possibly damaging Het
Exoc6b C G 6: 84,890,565 L288F possibly damaging Het
Gm884 A T 11: 103,614,609 S2178T possibly damaging Het
Ifi203 G A 1: 173,928,760 R486* probably null Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Lims2 A T 18: 31,944,155 Y58F probably damaging Het
Lrp12 A G 15: 39,878,282 F365L probably damaging Het
Mark4 T C 7: 19,451,725 D28G probably benign Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp1a A T 9: 7,464,869 K34N possibly damaging Het
Olfr730 T A 14: 50,186,612 T202S possibly damaging Het
P2rx5 G T 11: 73,160,660 V22L possibly damaging Het
Pnmal1 A G 7: 16,960,954 R245G possibly damaging Het
Prpsap1 T C 11: 116,478,584 S179G probably benign Het
Specc1 A G 11: 62,118,419 T334A probably benign Het
Tm7sf2 A G 19: 6,063,599 Y301H probably damaging Het
Unc13c G T 9: 73,932,586 H328N probably benign Het
Zfp641 T C 15: 98,290,540 D153G probably benign Het
Zp3 A G 5: 135,985,660 T278A probably benign Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Other mutations in Tas2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tas2r124 APN 6 132755529 missense probably benign 0.02
IGL01343:Tas2r124 APN 6 132755415 missense probably damaging 1.00
IGL01646:Tas2r124 APN 6 132755369 missense probably damaging 0.98
IGL01743:Tas2r124 APN 6 132754835 missense probably benign 0.01
IGL02251:Tas2r124 APN 6 132755561 missense probably benign 0.02
IGL03081:Tas2r124 APN 6 132755534 missense possibly damaging 0.61
IGL03309:Tas2r124 APN 6 132754935 missense probably benign 0.01
IGL03374:Tas2r124 APN 6 132755118 missense probably benign 0.00
P0012:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R1450:Tas2r124 UTSW 6 132755056 missense probably damaging 1.00
R1804:Tas2r124 UTSW 6 132755525 missense probably benign 0.11
R2048:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R2846:Tas2r124 UTSW 6 132755267 missense possibly damaging 0.73
R3416:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3417:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R4306:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4308:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4823:Tas2r124 UTSW 6 132755546 missense probably damaging 0.98
R4867:Tas2r124 UTSW 6 132755193 missense probably damaging 0.98
R4949:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R5242:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R6001:Tas2r124 UTSW 6 132755453 missense probably damaging 0.99
R6263:Tas2r124 UTSW 6 132754904 missense probably benign 0.45
R6313:Tas2r124 UTSW 6 132755447 missense probably benign 0.00
R6394:Tas2r124 UTSW 6 132755076 missense probably damaging 1.00
R7685:Tas2r124 UTSW 6 132755093 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTATATCATGGGTTGCTCAGAAG -3'
(R):5'- ACCCTTAGTCAGTGAGATAGTTTG -3'

Sequencing Primer
(F):5'- TTGCTCAGAAGAATCAAAGTGAACTG -3'
(R):5'- ACTGATACTCCAGGGGAATGCC -3'
Posted On2015-02-18